ID: 1036871229

View in Genome Browser
Species Human (GRCh38)
Location 8:12436320-12436342
Sequence TGGCGCCCGAGGAGAACGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 6, 1: 4, 2: 0, 3: 3, 4: 48}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036871229_1036871245 27 Left 1036871229 8:12436320-12436342 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036871245 8:12436370-12436392 CGGGAGACCTGGAGGAAGCCGGG 0: 2
1: 1
2: 6
3: 21
4: 355
1036871229_1036871238 8 Left 1036871229 8:12436320-12436342 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036871238 8:12436351-12436373 GCGAGGCCGCAGCCGTTGCCGGG 0: 2
1: 0
2: 1
3: 3
4: 126
1036871229_1036871240 16 Left 1036871229 8:12436320-12436342 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036871240 8:12436359-12436381 GCAGCCGTTGCCGGGAGACCTGG 0: 2
1: 0
2: 1
3: 13
4: 124
1036871229_1036871235 -9 Left 1036871229 8:12436320-12436342 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036871235 8:12436334-12436356 CGGGCGCCATAACGTGGGCGAGG 0: 2
1: 5
2: 2
3: 3
4: 27
1036871229_1036871241 19 Left 1036871229 8:12436320-12436342 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036871241 8:12436362-12436384 GCCGTTGCCGGGAGACCTGGAGG 0: 2
1: 0
2: 2
3: 17
4: 117
1036871229_1036871244 26 Left 1036871229 8:12436320-12436342 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036871244 8:12436369-12436391 CCGGGAGACCTGGAGGAAGCCGG 0: 3
1: 1
2: 3
3: 44
4: 360
1036871229_1036871237 7 Left 1036871229 8:12436320-12436342 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036871237 8:12436350-12436372 GGCGAGGCCGCAGCCGTTGCCGG 0: 2
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036871229 Original CRISPR TGGCGCCCGAGGAGAACGCG GGG (reversed) Exonic