ID: 1036872993

View in Genome Browser
Species Human (GRCh38)
Location 8:12448168-12448190
Sequence TGGGATGCCCCTGCCCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036872993_1036872998 13 Left 1036872993 8:12448168-12448190 CCAACTTGGGCAGGGGCATCCCA No data
Right 1036872998 8:12448204-12448226 GCACAATATCAAACTTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036872993 Original CRISPR TGGGATGCCCCTGCCCAAGT TGG (reversed) Intergenic
No off target data available for this crispr