ID: 1036872998

View in Genome Browser
Species Human (GRCh38)
Location 8:12448204-12448226
Sequence GCACAATATCAAACTTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036872992_1036872998 14 Left 1036872992 8:12448167-12448189 CCCAACTTGGGCAGGGGCATCCC No data
Right 1036872998 8:12448204-12448226 GCACAATATCAAACTTGACCAGG No data
1036872991_1036872998 15 Left 1036872991 8:12448166-12448188 CCCCAACTTGGGCAGGGGCATCC No data
Right 1036872998 8:12448204-12448226 GCACAATATCAAACTTGACCAGG No data
1036872993_1036872998 13 Left 1036872993 8:12448168-12448190 CCAACTTGGGCAGGGGCATCCCA No data
Right 1036872998 8:12448204-12448226 GCACAATATCAAACTTGACCAGG No data
1036872995_1036872998 -7 Left 1036872995 8:12448188-12448210 CCAAAGCCACCGTAGCGCACAAT No data
Right 1036872998 8:12448204-12448226 GCACAATATCAAACTTGACCAGG No data
1036872994_1036872998 -6 Left 1036872994 8:12448187-12448209 CCCAAAGCCACCGTAGCGCACAA No data
Right 1036872998 8:12448204-12448226 GCACAATATCAAACTTGACCAGG No data
1036872987_1036872998 22 Left 1036872987 8:12448159-12448181 CCTCTTGCCCCAACTTGGGCAGG No data
Right 1036872998 8:12448204-12448226 GCACAATATCAAACTTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036872998 Original CRISPR GCACAATATCAAACTTGACC AGG Intergenic
No off target data available for this crispr