ID: 1036876340

View in Genome Browser
Species Human (GRCh38)
Location 8:12476329-12476351
Sequence CCTCCTGGTGTTATTCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036876340_1036876347 8 Left 1036876340 8:12476329-12476351 CCACAGTGAATAACACCAGGAGG No data
Right 1036876347 8:12476360-12476382 TTAAGGTCCATTGTGAAGGATGG No data
1036876340_1036876344 -9 Left 1036876340 8:12476329-12476351 CCACAGTGAATAACACCAGGAGG No data
Right 1036876344 8:12476343-12476365 ACCAGGAGGTGGGAATATTAAGG No data
1036876340_1036876346 4 Left 1036876340 8:12476329-12476351 CCACAGTGAATAACACCAGGAGG No data
Right 1036876346 8:12476356-12476378 AATATTAAGGTCCATTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036876340 Original CRISPR CCTCCTGGTGTTATTCACTG TGG (reversed) Intergenic
No off target data available for this crispr