ID: 1036876989

View in Genome Browser
Species Human (GRCh38)
Location 8:12481797-12481819
Sequence CACACGGACGCGCCAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036876989_1036876991 -5 Left 1036876989 8:12481797-12481819 CCTTTTTCTGGCGCGTCCGTGTG No data
Right 1036876991 8:12481815-12481837 GTGTGAAGAGACCACAAAACAGG 0: 15
1: 1220
2: 1135
3: 381
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036876989 Original CRISPR CACACGGACGCGCCAGAAAA AGG (reversed) Intergenic
No off target data available for this crispr