ID: 1036876991

View in Genome Browser
Species Human (GRCh38)
Location 8:12481815-12481837
Sequence GTGTGAAGAGACCACAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2966
Summary {0: 15, 1: 1220, 2: 1135, 3: 381, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036876988_1036876991 -4 Left 1036876988 8:12481796-12481818 CCCTTTTTCTGGCGCGTCCGTGT No data
Right 1036876991 8:12481815-12481837 GTGTGAAGAGACCACAAAACAGG 0: 15
1: 1220
2: 1135
3: 381
4: 215
1036876985_1036876991 29 Left 1036876985 8:12481763-12481785 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1036876991 8:12481815-12481837 GTGTGAAGAGACCACAAAACAGG 0: 15
1: 1220
2: 1135
3: 381
4: 215
1036876989_1036876991 -5 Left 1036876989 8:12481797-12481819 CCTTTTTCTGGCGCGTCCGTGTG No data
Right 1036876991 8:12481815-12481837 GTGTGAAGAGACCACAAAACAGG 0: 15
1: 1220
2: 1135
3: 381
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036876991 Original CRISPR GTGTGAAGAGACCACAAAAC AGG Intergenic
Too many off-targets to display for this crispr