ID: 1036877906

View in Genome Browser
Species Human (GRCh38)
Location 8:12489063-12489085
Sequence AAGGGCTTATTGAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036877906_1036877913 9 Left 1036877906 8:12489063-12489085 CCCCCAGAGTTCAATAAGCCCTT No data
Right 1036877913 8:12489095-12489117 TAATGTTCCATGCATTTGAAGGG No data
1036877906_1036877915 18 Left 1036877906 8:12489063-12489085 CCCCCAGAGTTCAATAAGCCCTT No data
Right 1036877915 8:12489104-12489126 ATGCATTTGAAGGGTTGAAAAGG No data
1036877906_1036877912 8 Left 1036877906 8:12489063-12489085 CCCCCAGAGTTCAATAAGCCCTT No data
Right 1036877912 8:12489094-12489116 ATAATGTTCCATGCATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036877906 Original CRISPR AAGGGCTTATTGAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr