ID: 1036877915

View in Genome Browser
Species Human (GRCh38)
Location 8:12489104-12489126
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036877910_1036877915 0 Left 1036877910 8:12489081-12489103 CCCTTTTCTTTATATAATGTTCC No data
Right 1036877915 8:12489104-12489126 ATGCATTTGAAGGGTTGAAAAGG No data
1036877907_1036877915 17 Left 1036877907 8:12489064-12489086 CCCCAGAGTTCAATAAGCCCTTT No data
Right 1036877915 8:12489104-12489126 ATGCATTTGAAGGGTTGAAAAGG No data
1036877909_1036877915 15 Left 1036877909 8:12489066-12489088 CCAGAGTTCAATAAGCCCTTTTC No data
Right 1036877915 8:12489104-12489126 ATGCATTTGAAGGGTTGAAAAGG No data
1036877906_1036877915 18 Left 1036877906 8:12489063-12489085 CCCCCAGAGTTCAATAAGCCCTT No data
Right 1036877915 8:12489104-12489126 ATGCATTTGAAGGGTTGAAAAGG No data
1036877908_1036877915 16 Left 1036877908 8:12489065-12489087 CCCAGAGTTCAATAAGCCCTTTT No data
Right 1036877915 8:12489104-12489126 ATGCATTTGAAGGGTTGAAAAGG No data
1036877911_1036877915 -1 Left 1036877911 8:12489082-12489104 CCTTTTCTTTATATAATGTTCCA No data
Right 1036877915 8:12489104-12489126 ATGCATTTGAAGGGTTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036877915 Original CRISPR ATGCATTTGAAGGGTTGAAA AGG Intergenic
No off target data available for this crispr