ID: 1036889961

View in Genome Browser
Species Human (GRCh38)
Location 8:12590098-12590120
Sequence TCTGCACCCTGGTGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036889961_1036889968 1 Left 1036889961 8:12590098-12590120 CCCCCAGGACACCAGGGTGCAGA No data
Right 1036889968 8:12590122-12590144 TGGTGTGAGTAAAAGAAAGAGGG No data
1036889961_1036889969 2 Left 1036889961 8:12590098-12590120 CCCCCAGGACACCAGGGTGCAGA No data
Right 1036889969 8:12590123-12590145 GGTGTGAGTAAAAGAAAGAGGGG No data
1036889961_1036889967 0 Left 1036889961 8:12590098-12590120 CCCCCAGGACACCAGGGTGCAGA No data
Right 1036889967 8:12590121-12590143 CTGGTGTGAGTAAAAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036889961 Original CRISPR TCTGCACCCTGGTGTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr