ID: 1036891157

View in Genome Browser
Species Human (GRCh38)
Location 8:12598114-12598136
Sequence GCTGTGGGTCAGACACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036891151_1036891157 17 Left 1036891151 8:12598074-12598096 CCAAATACCTAGGAGAGACTTTT No data
Right 1036891157 8:12598114-12598136 GCTGTGGGTCAGACACACCCTGG No data
1036891152_1036891157 10 Left 1036891152 8:12598081-12598103 CCTAGGAGAGACTTTTCTCTCTC No data
Right 1036891157 8:12598114-12598136 GCTGTGGGTCAGACACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036891157 Original CRISPR GCTGTGGGTCAGACACACCC TGG Intergenic
No off target data available for this crispr