ID: 1036891544

View in Genome Browser
Species Human (GRCh38)
Location 8:12600498-12600520
Sequence ACGTTGGCCCCTGAATCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036891544_1036891555 17 Left 1036891544 8:12600498-12600520 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036891555 8:12600538-12600560 CTCACAGGGACAGCGCCCCGGGG No data
1036891544_1036891550 2 Left 1036891544 8:12600498-12600520 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036891550 8:12600523-12600545 GCAGGACACCGGGAGCTCACAGG No data
1036891544_1036891551 3 Left 1036891544 8:12600498-12600520 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036891551 8:12600524-12600546 CAGGACACCGGGAGCTCACAGGG No data
1036891544_1036891548 -8 Left 1036891544 8:12600498-12600520 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036891548 8:12600513-12600535 GCCAACGTTTGCAGGACACCGGG No data
1036891544_1036891556 25 Left 1036891544 8:12600498-12600520 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036891556 8:12600546-12600568 GACAGCGCCCCGGGGATGCAAGG No data
1036891544_1036891554 16 Left 1036891544 8:12600498-12600520 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036891554 8:12600537-12600559 GCTCACAGGGACAGCGCCCCGGG No data
1036891544_1036891553 15 Left 1036891544 8:12600498-12600520 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036891553 8:12600536-12600558 AGCTCACAGGGACAGCGCCCCGG No data
1036891544_1036891547 -9 Left 1036891544 8:12600498-12600520 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036891547 8:12600512-12600534 GGCCAACGTTTGCAGGACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036891544 Original CRISPR ACGTTGGCCCCTGAATCACC GGG (reversed) Intergenic
No off target data available for this crispr