ID: 1036892543

View in Genome Browser
Species Human (GRCh38)
Location 8:12605959-12605981
Sequence TAGCATGACCTGAAGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036892543_1036892551 14 Left 1036892543 8:12605959-12605981 CCATCATCCTTCAGGTCATGCTA No data
Right 1036892551 8:12605996-12606018 TGTGGACCAAACAATTCAGTGGG No data
1036892543_1036892550 13 Left 1036892543 8:12605959-12605981 CCATCATCCTTCAGGTCATGCTA No data
Right 1036892550 8:12605995-12606017 CTGTGGACCAAACAATTCAGTGG No data
1036892543_1036892552 15 Left 1036892543 8:12605959-12605981 CCATCATCCTTCAGGTCATGCTA No data
Right 1036892552 8:12605997-12606019 GTGGACCAAACAATTCAGTGGGG No data
1036892543_1036892545 -4 Left 1036892543 8:12605959-12605981 CCATCATCCTTCAGGTCATGCTA No data
Right 1036892545 8:12605978-12606000 GCTATTCCCATTTCCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036892543 Original CRISPR TAGCATGACCTGAAGGATGA TGG (reversed) Intergenic
No off target data available for this crispr