ID: 1036893875

View in Genome Browser
Species Human (GRCh38)
Location 8:12615089-12615111
Sequence TAGGCTCAGGTTGTCTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036893875_1036893883 24 Left 1036893875 8:12615089-12615111 CCATCTGAGACAACCTGAGCCTA No data
Right 1036893883 8:12615136-12615158 AGCATTTTGGGCAAGTCTCTAGG No data
1036893875_1036893881 12 Left 1036893875 8:12615089-12615111 CCATCTGAGACAACCTGAGCCTA No data
Right 1036893881 8:12615124-12615146 CATATAACCATCAGCATTTTGGG No data
1036893875_1036893880 11 Left 1036893875 8:12615089-12615111 CCATCTGAGACAACCTGAGCCTA No data
Right 1036893880 8:12615123-12615145 CCATATAACCATCAGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036893875 Original CRISPR TAGGCTCAGGTTGTCTCAGA TGG (reversed) Intergenic
No off target data available for this crispr