ID: 1036893877

View in Genome Browser
Species Human (GRCh38)
Location 8:12615108-12615130
Sequence TTATATGGGCAATAAAGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036893877_1036893883 5 Left 1036893877 8:12615108-12615130 CCTAAACTTTATTGCCCATATAA No data
Right 1036893883 8:12615136-12615158 AGCATTTTGGGCAAGTCTCTAGG No data
1036893877_1036893881 -7 Left 1036893877 8:12615108-12615130 CCTAAACTTTATTGCCCATATAA No data
Right 1036893881 8:12615124-12615146 CATATAACCATCAGCATTTTGGG No data
1036893877_1036893880 -8 Left 1036893877 8:12615108-12615130 CCTAAACTTTATTGCCCATATAA No data
Right 1036893880 8:12615123-12615145 CCATATAACCATCAGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036893877 Original CRISPR TTATATGGGCAATAAAGTTT AGG (reversed) Intergenic
No off target data available for this crispr