ID: 1036893879

View in Genome Browser
Species Human (GRCh38)
Location 8:12615123-12615145
Sequence CCAAAATGCTGATGGTTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036893879_1036893883 -10 Left 1036893879 8:12615123-12615145 CCATATAACCATCAGCATTTTGG No data
Right 1036893883 8:12615136-12615158 AGCATTTTGGGCAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036893879 Original CRISPR CCAAAATGCTGATGGTTATA TGG (reversed) Intergenic
No off target data available for this crispr