ID: 1036893880

View in Genome Browser
Species Human (GRCh38)
Location 8:12615123-12615145
Sequence CCATATAACCATCAGCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036893876_1036893880 -2 Left 1036893876 8:12615102-12615124 CCTGAGCCTAAACTTTATTGCCC No data
Right 1036893880 8:12615123-12615145 CCATATAACCATCAGCATTTTGG No data
1036893872_1036893880 30 Left 1036893872 8:12615070-12615092 CCCAACAAGCTCCTCATTTCCAT No data
Right 1036893880 8:12615123-12615145 CCATATAACCATCAGCATTTTGG No data
1036893875_1036893880 11 Left 1036893875 8:12615089-12615111 CCATCTGAGACAACCTGAGCCTA No data
Right 1036893880 8:12615123-12615145 CCATATAACCATCAGCATTTTGG No data
1036893874_1036893880 19 Left 1036893874 8:12615081-12615103 CCTCATTTCCATCTGAGACAACC No data
Right 1036893880 8:12615123-12615145 CCATATAACCATCAGCATTTTGG No data
1036893873_1036893880 29 Left 1036893873 8:12615071-12615093 CCAACAAGCTCCTCATTTCCATC No data
Right 1036893880 8:12615123-12615145 CCATATAACCATCAGCATTTTGG No data
1036893877_1036893880 -8 Left 1036893877 8:12615108-12615130 CCTAAACTTTATTGCCCATATAA No data
Right 1036893880 8:12615123-12615145 CCATATAACCATCAGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036893880 Original CRISPR CCATATAACCATCAGCATTT TGG Intergenic
No off target data available for this crispr