ID: 1036893883

View in Genome Browser
Species Human (GRCh38)
Location 8:12615136-12615158
Sequence AGCATTTTGGGCAAGTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036893875_1036893883 24 Left 1036893875 8:12615089-12615111 CCATCTGAGACAACCTGAGCCTA No data
Right 1036893883 8:12615136-12615158 AGCATTTTGGGCAAGTCTCTAGG No data
1036893876_1036893883 11 Left 1036893876 8:12615102-12615124 CCTGAGCCTAAACTTTATTGCCC No data
Right 1036893883 8:12615136-12615158 AGCATTTTGGGCAAGTCTCTAGG No data
1036893879_1036893883 -10 Left 1036893879 8:12615123-12615145 CCATATAACCATCAGCATTTTGG No data
Right 1036893883 8:12615136-12615158 AGCATTTTGGGCAAGTCTCTAGG No data
1036893877_1036893883 5 Left 1036893877 8:12615108-12615130 CCTAAACTTTATTGCCCATATAA No data
Right 1036893883 8:12615136-12615158 AGCATTTTGGGCAAGTCTCTAGG No data
1036893878_1036893883 -9 Left 1036893878 8:12615122-12615144 CCCATATAACCATCAGCATTTTG No data
Right 1036893883 8:12615136-12615158 AGCATTTTGGGCAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036893883 Original CRISPR AGCATTTTGGGCAAGTCTCT AGG Intergenic
No off target data available for this crispr