ID: 1036897574

View in Genome Browser
Species Human (GRCh38)
Location 8:12648259-12648281
Sequence TCTGCACCCTGGTGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036897574_1036897581 5 Left 1036897574 8:12648259-12648281 CCCCCAGGACACCAGGGTGCAGA No data
Right 1036897581 8:12648287-12648309 GTGAGTAAAAGAAAGAGAGGCGG No data
1036897574_1036897580 2 Left 1036897574 8:12648259-12648281 CCCCCAGGACACCAGGGTGCAGA No data
Right 1036897580 8:12648284-12648306 GGTGTGAGTAAAAGAAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036897574 Original CRISPR TCTGCACCCTGGTGTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr