ID: 1036898713

View in Genome Browser
Species Human (GRCh38)
Location 8:12656054-12656076
Sequence GCTGTGGGTCAGACACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036898705_1036898713 10 Left 1036898705 8:12656021-12656043 CCTAGGAGAGACTTTGCTCTCCC No data
Right 1036898713 8:12656054-12656076 GCTGTGGGTCAGACACACCCTGG No data
1036898704_1036898713 17 Left 1036898704 8:12656014-12656036 CCAAATACCTAGGAGAGACTTTG No data
Right 1036898713 8:12656054-12656076 GCTGTGGGTCAGACACACCCTGG No data
1036898710_1036898713 -10 Left 1036898710 8:12656041-12656063 CCCTCCAGGAGGAGCTGTGGGTC No data
Right 1036898713 8:12656054-12656076 GCTGTGGGTCAGACACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036898713 Original CRISPR GCTGTGGGTCAGACACACCC TGG Intergenic
No off target data available for this crispr