ID: 1036899086

View in Genome Browser
Species Human (GRCh38)
Location 8:12658462-12658484
Sequence ACGTGGGCCCCTGAGTCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 6, 1: 3, 2: 9, 3: 9, 4: 152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036899086_1036899090 -8 Left 1036899086 8:12658462-12658484 CCCGGTGACTCAGGGGCCCACGT 0: 6
1: 3
2: 9
3: 9
4: 152
Right 1036899090 8:12658477-12658499 GCCCACGTGTGCAGGACACCGGG No data
1036899086_1036899089 -9 Left 1036899086 8:12658462-12658484 CCCGGTGACTCAGGGGCCCACGT 0: 6
1: 3
2: 9
3: 9
4: 152
Right 1036899089 8:12658476-12658498 GGCCCACGTGTGCAGGACACCGG No data
1036899086_1036899098 26 Left 1036899086 8:12658462-12658484 CCCGGTGACTCAGGGGCCCACGT 0: 6
1: 3
2: 9
3: 9
4: 152
Right 1036899098 8:12658511-12658533 ACAGCGCCCCAGGGAATGCAAGG No data
1036899086_1036899097 17 Left 1036899086 8:12658462-12658484 CCCGGTGACTCAGGGGCCCACGT 0: 6
1: 3
2: 9
3: 9
4: 152
Right 1036899097 8:12658502-12658524 CTCATAGGGACAGCGCCCCAGGG No data
1036899086_1036899094 3 Left 1036899086 8:12658462-12658484 CCCGGTGACTCAGGGGCCCACGT 0: 6
1: 3
2: 9
3: 9
4: 152
Right 1036899094 8:12658488-12658510 CAGGACACCGGGAGCTCATAGGG No data
1036899086_1036899093 2 Left 1036899086 8:12658462-12658484 CCCGGTGACTCAGGGGCCCACGT 0: 6
1: 3
2: 9
3: 9
4: 152
Right 1036899093 8:12658487-12658509 GCAGGACACCGGGAGCTCATAGG No data
1036899086_1036899096 16 Left 1036899086 8:12658462-12658484 CCCGGTGACTCAGGGGCCCACGT 0: 6
1: 3
2: 9
3: 9
4: 152
Right 1036899096 8:12658501-12658523 GCTCATAGGGACAGCGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036899086 Original CRISPR ACGTGGGCCCCTGAGTCACC GGG (reversed) Intergenic
900137188 1:1122574-1122596 AGGGGGGCCCCTGAGGCACGGGG - Intergenic
900146377 1:1160660-1160682 CCGTGGGCCCCAGCGACACCTGG + Intergenic
900333798 1:2150724-2150746 GCGTGGTCCTCTGAGTCTCCCGG + Intronic
901420159 1:9145284-9145306 ACGTGGACCCCTCAGGCACCGGG + Intergenic
902618099 1:17634856-17634878 ACTTGGGCCCCAGGGGCACCAGG - Exonic
913122495 1:115754690-115754712 ACCTGGGCCTCTGAGGGACCTGG + Intronic
913348918 1:117836149-117836171 TCCTGGGCTCCTGAGTCAGCTGG + Intergenic
919821535 1:201476082-201476104 ACGTGGGCGTCAGAATCACCTGG - Intergenic
920258617 1:204673933-204673955 ACCTGGGCCCAGGAGTCACTTGG - Intronic
1064119321 10:12605512-12605534 GAGTGGGCCCCTGAGTGGCCTGG - Intronic
1064295536 10:14076066-14076088 ACCTGGGCCTCTGAATAACCGGG + Intronic
1070670645 10:78375090-78375112 CTGTGGGTTCCTGAGTCACCAGG - Intergenic
1073736123 10:106348957-106348979 ACCTGGGTCTCTGAGCCACCAGG - Intergenic
1074765102 10:116694736-116694758 ACGTGGCCTCCTGGGCCACCAGG + Intronic
1076441035 10:130481532-130481554 ATGAGGGCCCCGGAGACACCTGG - Intergenic
1077467099 11:2738603-2738625 TCCTGGGCCCCCGAGTCACCAGG + Intronic
1077601871 11:3580264-3580286 ACGTGAGCCCCTGAGTCACCGGG - Intergenic
1079280518 11:19083106-19083128 ACCTGGGGCCCTCAGTCACTGGG - Intergenic
1081867589 11:46367965-46367987 GAGAGGGCCCCTGAGGCACCAGG - Intronic
1083578963 11:63813209-63813231 ACGCGGGCCCCTCAGTCTGCGGG - Intergenic
1083869391 11:65477576-65477598 ACGCCGGGCGCTGAGTCACCGGG + Intergenic
1084257784 11:67954810-67954832 ACGTGAGCCCCTGAGTTACCGGG - Intergenic
1084814982 11:71640427-71640449 ACGTGGAACCCTGAGTCACCGGG + Intergenic
1089790863 11:120942501-120942523 TGATGGGCCACTGAGTCACCAGG - Intronic
1092428015 12:8389607-8389629 ATGTGAGCCCCTGAGTCAGCGGG - Intergenic
1099097726 12:78396337-78396359 ACTTGGGTCCCAGAGTCACATGG + Intergenic
1104490181 12:129187203-129187225 GCTTGGATCCCTGAGTCACCAGG + Intronic
1104897100 12:132169688-132169710 ACGGGGGCCCCTGAGGCTGCTGG + Intergenic
1109416367 13:62046440-62046462 AGCTGGGCCCCTGAGTCAGGTGG - Intergenic
1110999996 13:82165810-82165832 ACCTGGGCCTCTGACTCACTAGG - Intergenic
1113950629 13:114069496-114069518 TCCTGGCCCCCTGAGTCTCCTGG - Intronic
1115396073 14:32909726-32909748 ACATGGGTCCCTGATTCCCCTGG - Intergenic
1120327842 14:83052324-83052346 ACAAGAGCCCCTGACTCACCGGG + Intergenic
1121115351 14:91339155-91339177 ACGTGTGCCCCGGAGTCAGCTGG - Intronic
1121531104 14:94654131-94654153 ACATGGGCCTCTGAGTCAGGGGG + Intergenic
1122918399 14:104869291-104869313 ACGTGGGCCCCTGACCCAGGTGG + Intronic
1124485393 15:30110307-30110329 AAGTGGACACCTGAGTCAGCAGG + Intergenic
1124518183 15:30386960-30386982 AAGTGGACACCTGAGTCAGCAGG - Exonic
1124540470 15:30579293-30579315 AAGTGGACACCTGAGTCAGCAGG + Intergenic
1124758183 15:32428288-32428310 AAGTGGACACCTGAGTCAGCAGG - Intergenic
1128450733 15:67804662-67804684 ATATGGGCCCCAAAGTCACCCGG + Intronic
1129199615 15:73991250-73991272 ACTTGGGCTCCTGAATCTCCAGG - Intronic
1129868307 15:78925315-78925337 TCCTGGGACCCTGACTCACCTGG + Exonic
1131573873 15:93566884-93566906 GAGTGGTCCCCTGAGTCAACAGG + Intergenic
1132199477 15:99940336-99940358 ACTTGGGAGCCTGAGTCAGCAGG - Intergenic
1132702889 16:1229553-1229575 GCGTGGGACCGTGAGTCTCCCGG - Exonic
1132705436 16:1241315-1241337 GCGTGGGACCGTGAGTCTCCCGG + Exonic
1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG + Intronic
1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG + Intergenic
1133557393 16:6918386-6918408 TAGTGGGCCCCAGAATCACCCGG - Intronic
1134208255 16:12254784-12254806 AGTTGGTCCCCTGAGTCATCTGG + Intronic
1134757115 16:16677267-16677289 TCCTGGGCCACTCAGTCACCTGG - Intergenic
1134988953 16:18681896-18681918 TCCTGGGCCACTCAGTCACCTGG + Intergenic
1135503183 16:23014674-23014696 ACCTGGGACCCTGAGTGACACGG - Intergenic
1139926203 16:70488500-70488522 ACTTGGGACCCTGAGTCAGGAGG - Intronic
1141145041 16:81523425-81523447 ACGTGGGGCCCACAGTCACACGG + Intronic
1141774897 16:86116675-86116697 ACGAGGGCCCCTGGATCACGAGG + Intergenic
1141881761 16:86864925-86864947 ACGTTGGCTCCTGAGTGGCCTGG + Intergenic
1143134455 17:4703844-4703866 ACGCGGGCCACGGACTCACCTGG + Exonic
1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG + Intronic
1146590824 17:34126759-34126781 TAGTGGGCACATGAGTCACCTGG + Intronic
1147201653 17:38806278-38806300 AACTGGGCTCCTGACTCACCTGG + Exonic
1148770492 17:50063369-50063391 ACCTGGGCCCCTAAGCGACCTGG - Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151478578 17:74357026-74357048 ACGCGGGCCGCCGGGTCACCTGG - Exonic
1152322881 17:79618103-79618125 ACGTGGGACCCTGAACTACCTGG - Intergenic
1152363183 17:79841743-79841765 GCGTGGGCCCCTGAGGGGCCTGG - Intergenic
1152379353 17:79934421-79934443 TCAGGGGCCCCTGAGCCACCAGG + Exonic
1153490249 18:5640082-5640104 CTGTAGGACCCTGAGTCACCTGG + Intergenic
1154493531 18:14939356-14939378 CCCTGGGCCCCTGAGCCACTGGG - Intergenic
1157193381 18:45599939-45599961 ACTTGCCCCCATGAGTCACCAGG + Intronic
1158694945 18:59696077-59696099 ATGTGGGCCACAGATTCACCTGG - Intronic
1160047607 18:75401149-75401171 ACGTGGCCACCTGAGTCATAGGG - Intergenic
1160686895 19:441051-441073 ACGACGGCCCCAGAGCCACCAGG - Intronic
1161130842 19:2587609-2587631 GCCTGGGCTGCTGAGTCACCCGG + Intronic
1161165139 19:2782873-2782895 ACGGGGGTCCCTGAGTCACAGGG + Intronic
1161574529 19:5048358-5048380 GTGTGTGCCCCTGTGTCACCGGG + Intronic
1161652458 19:5493573-5493595 AAGAGGGTCCCTCAGTCACCTGG - Intergenic
1164981085 19:32615094-32615116 ATCTGGGCCCCTGAGTCCCGTGG - Intronic
1165012438 19:32858625-32858647 AGGTGGGTCCCTGGGTCCCCTGG - Intronic
1165075125 19:33276196-33276218 TCGTGGGCCTCTGAGTAAACAGG + Intergenic
1166270482 19:41710425-41710447 ACAGGCTCCCCTGAGTCACCTGG - Intronic
1167320762 19:48796106-48796128 CCGTGGGCCTCTGAGGCCCCTGG - Intronic
1167645053 19:50701122-50701144 ACCTGGGCCCCTGAATAAGCAGG - Intronic
1168413624 19:56155466-56155488 ACCTGGGGCCCTGGGCCACCCGG - Intronic
926192802 2:10741401-10741423 CCAGGGGCTCCTGAGTCACCAGG + Intronic
926388911 2:12367177-12367199 ACTTGGAGCCCTGAGCCACCAGG - Intergenic
928267090 2:29821269-29821291 AGGTGGCCCTCTGAGTCACTAGG + Intronic
934488296 2:94738150-94738172 CCGTGGGCCACTGGGCCACCCGG - Intergenic
934660252 2:96139329-96139351 AGGTGGGGCCCTGAGTGACCTGG - Intergenic
934787847 2:97027959-97027981 ACATAAACCCCTGAGTCACCTGG + Intergenic
935730606 2:106062225-106062247 ACTGAGGCCCCTGAGTCACGTGG + Intergenic
938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG + Intergenic
938771457 2:134504706-134504728 ACGTGGCCCCATGATCCACCAGG + Intronic
942947284 2:181684150-181684172 TCGCGGGCCCCTCAGCCACCCGG - Intergenic
1169376458 20:5070172-5070194 AAGTGGACTCCTGAGCCACCTGG + Intronic
1173534710 20:43800690-43800712 ACTTGGGCCCCTGAGGCAGGAGG - Intergenic
1173898441 20:46568813-46568835 AGCTGGGCCTCTGAGTGACCGGG + Intronic
1175318063 20:58065681-58065703 TGATGTGCCCCTGAGTCACCTGG - Intergenic
1175951523 20:62586158-62586180 ACCTGTGCCCCTGAGGCCCCTGG - Intergenic
1176052723 20:63129052-63129074 ACGTGGGCACCTGACTTTCCTGG + Intergenic
1178717935 21:34983891-34983913 CCATTGGCCCCTGAGTCAGCAGG - Intronic
1179358714 21:40685474-40685496 ACCTTGGCCACTGAGTCTCCAGG + Intronic
1179538523 21:42068256-42068278 GTGTGAGCACCTGAGTCACCCGG + Intronic
1179623322 21:42632950-42632972 AAGTGGGACCCTGAGACACGGGG - Intergenic
1179731254 21:43368518-43368540 ACGTGAGCCCAGCAGTCACCAGG + Intergenic
1180303200 22:11053783-11053805 ACGTTGGCCTCTGAGGCTCCGGG + Intergenic
1180979458 22:19871861-19871883 ACGTGGGCCCCCATGCCACCAGG - Intergenic
1181313791 22:21959502-21959524 ACGTGGGGACCTGGGTCCCCAGG + Intronic
1183096740 22:35556629-35556651 ACCTGGGTGCCTGAGTGACCAGG - Intergenic
1184211197 22:43036568-43036590 ACGTTGGCCTCTGAGGCTCCGGG - Intergenic
1184339557 22:43878882-43878904 ACCTGGCCACCTGGGTCACCAGG - Intergenic
1184421735 22:44386161-44386183 ACGGGGCTCCCTGAGCCACCTGG + Intergenic
1185388540 22:50547333-50547355 TCGTAGGCCCCTGTGGCACCCGG - Intergenic
950023544 3:9805837-9805859 ACTTGGCCCTCTGAGTCCCCAGG + Intronic
950330779 3:12154495-12154517 ACCTGGGCCCCTGGGGCTCCAGG - Intronic
953313204 3:41900802-41900824 AAGTGGACACCTGAGTCAGCAGG - Exonic
957072712 3:75579298-75579320 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
958541168 3:95475265-95475287 AGGTGGGCCCTTGAGTCCCGGGG - Intergenic
961281362 3:125767453-125767475 ACGTGGGCCCCTGAGTCACTGGG + Intergenic
961302978 3:125933994-125934016 AGGTGGGCCCCTGGGTAAGCTGG - Intronic
961873007 3:130002126-130002148 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
962618360 3:137150983-137151005 AGGTGGGCACCTGAGCCTCCTGG - Intergenic
963068679 3:141284213-141284235 ACCTGGGGCCCTGAATGACCAGG - Intronic
968750233 4:2385114-2385136 AGGTGGGTCCCTGAGTGACTTGG - Intronic
969016318 4:4106608-4106630 ACCTGGGCCCCTGAGCCACCGGG - Intergenic
969377026 4:6769550-6769572 CAGTGGGCCCCTGAGACAGCTGG - Intergenic
969737636 4:9001716-9001738 ACGTGGAACCCTGAGTCACCGGG + Intergenic
969796835 4:9533277-9533299 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
972733576 4:41818556-41818578 AACTGGGTCCCTTAGTCACCTGG + Intergenic
981673271 4:147311867-147311889 TCCTGGGCCCATAAGTCACCAGG + Intergenic
983758021 4:171365942-171365964 ACTTGGGCCCCTAACTCTCCAGG - Intergenic
985679036 5:1246432-1246454 AGGCGGCCCCCTGAGCCACCCGG - Intergenic
985745373 5:1643794-1643816 CCATGTGGCCCTGAGTCACCGGG + Intergenic
991657494 5:68918614-68918636 ACCTGGACCCATGACTCACCTGG - Intergenic
1001163626 5:169343623-169343645 ACGTGGTCCCCAGATTCCCCTGG - Intergenic
1001583962 5:172820361-172820383 ACTTGGGCCCCAGACTCCCCAGG + Intergenic
1002620265 5:180483188-180483210 ACCTGGGTCCCTGAATCACACGG + Intergenic
1003050766 6:2779071-2779093 ACTGGGGCTCCTAAGTCACCAGG - Intronic
1005875430 6:30007130-30007152 CCCTGGTCCCCTGAGTCTCCGGG + Intergenic
1015440580 6:133241893-133241915 GCGTGGGCGCCTGCGTCCCCGGG + Intronic
1017772720 6:157655397-157655419 ACGTGGGCACTGGAGTCGCCAGG - Intronic
1019299458 7:296104-296126 AAGTCGGACCCTGAGTCCCCAGG - Intergenic
1019647234 7:2137552-2137574 GCCTGGGCCCCTCACTCACCTGG - Intronic
1020119543 7:5495388-5495410 GCGTGTCACCCTGAGTCACCCGG - Intronic
1021891292 7:25188465-25188487 ACCTGGGTCCCAGAGTCACCTGG - Intergenic
1022589936 7:31651966-31651988 ACGTGAGGCCCTGAGGCAGCAGG + Exonic
1028392762 7:90334867-90334889 AGCTGGGCCCCTGAGTCTACTGG + Intergenic
1035249315 7:157586697-157586719 AGCGGGGCCCCTGAGTCTCCAGG - Intronic
1036242731 8:7092976-7092998 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
1036258074 8:7221052-7221074 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036310124 8:7679648-7679670 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036359411 8:8066454-8066476 ACGTTGGCCCCTGAATCACCGGG + Intergenic
1036829998 8:12014168-12014190 ACGTGGGCCCCTGAGTCACCGGG - Intronic
1036891544 8:12600498-12600520 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036899086 8:12658462-12658484 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
1041107139 8:54454539-54454561 CCGTGGGCCCCTGAGTGACCAGG - Intergenic
1043073576 8:75667682-75667704 ATCTGGATCCCTGAGTCACCAGG - Intergenic
1045004959 8:97909650-97909672 CCGTGGGCCCCTCACTCACTCGG - Intronic
1045272615 8:100674814-100674836 AGCTGTGCACCTGAGTCACCTGG + Intergenic
1048016203 8:130499810-130499832 ATGTGGGGCACTGAGTCTCCAGG + Intergenic
1049414358 8:142488547-142488569 ACGTGGGCCCCAGAGTCGGACGG + Intronic
1052122885 9:24738989-24739011 ACCTGGGCTCCTGAGTCAGGTGG + Intergenic
1053669492 9:40346214-40346236 CCGTGGGCCACTGGGCCACCTGG + Intergenic
1053919288 9:42972456-42972478 CCGTGGGCCACTGGGCCACCCGG + Intergenic
1054380624 9:64486234-64486256 CCGTGGGCCACTGGGCCACCCGG + Intergenic
1054458726 9:65450476-65450498 ACGTGGGTCCCTCAGGTACCTGG - Intergenic
1054515122 9:66030077-66030099 CCGTGGGCCACTGGGCCACCTGG - Intergenic
1056736012 9:89209812-89209834 AGGTGGGCTCCTGAGTCTCCTGG + Intergenic
1057598514 9:96437152-96437174 GCCTGGACCCCTGAGTAACCGGG + Intergenic
1062404488 9:136388672-136388694 AGGTGGGCCCATGAGCCACTGGG + Intronic
1186758106 X:12694331-12694353 AGCTGGGCCTCTGTGTCACCTGG - Exonic
1186762911 X:12741966-12741988 ACTTGGCCCCCTGATTCACTTGG + Intergenic
1187347922 X:18483958-18483980 AAGTAGGCTCCTTAGTCACCAGG + Intronic
1190115738 X:47625406-47625428 ACCTGGGCCCCTCTGGCACCTGG + Intronic
1194244952 X:91499861-91499883 ATGTGGGCCCCTTTGTAACCAGG - Intergenic
1199996737 X:153030697-153030719 ACGTGGTCATCTGGGTCACCGGG - Intergenic
1200034421 X:153318767-153318789 ACGTGGTCATCTGAGTCACTGGG + Intergenic
1200248959 X:154542079-154542101 CCGGGGGCTCATGAGTCACCGGG + Intronic