ID: 1036899964

View in Genome Browser
Species Human (GRCh38)
Location 8:12663083-12663105
Sequence GCTGTGGGTCAGACACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036899956_1036899964 10 Left 1036899956 8:12663050-12663072 CCTAGGAGAGACTTTTCTCTCCC No data
Right 1036899964 8:12663083-12663105 GCTGTGGGTCAGACACACCCTGG No data
1036899955_1036899964 17 Left 1036899955 8:12663043-12663065 CCAAATACCTAGGAGAGACTTTT No data
Right 1036899964 8:12663083-12663105 GCTGTGGGTCAGACACACCCTGG No data
1036899961_1036899964 -10 Left 1036899961 8:12663070-12663092 CCCTCCAGGAGGAGCTGTGGGTC No data
Right 1036899964 8:12663083-12663105 GCTGTGGGTCAGACACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036899964 Original CRISPR GCTGTGGGTCAGACACACCC TGG Intergenic
No off target data available for this crispr