ID: 1036905799

View in Genome Browser
Species Human (GRCh38)
Location 8:12707588-12707610
Sequence GTGTACACACACTTCGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036905799_1036905809 15 Left 1036905799 8:12707588-12707610 CCAACATCGAAGTGTGTGTACAC No data
Right 1036905809 8:12707626-12707648 GTTTTTAATATCCAGGGGGCGGG No data
1036905799_1036905808 14 Left 1036905799 8:12707588-12707610 CCAACATCGAAGTGTGTGTACAC No data
Right 1036905808 8:12707625-12707647 GGTTTTTAATATCCAGGGGGCGG No data
1036905799_1036905810 18 Left 1036905799 8:12707588-12707610 CCAACATCGAAGTGTGTGTACAC No data
Right 1036905810 8:12707629-12707651 TTTAATATCCAGGGGGCGGGAGG No data
1036905799_1036905804 8 Left 1036905799 8:12707588-12707610 CCAACATCGAAGTGTGTGTACAC No data
Right 1036905804 8:12707619-12707641 TGATATGGTTTTTAATATCCAGG No data
1036905799_1036905806 10 Left 1036905799 8:12707588-12707610 CCAACATCGAAGTGTGTGTACAC No data
Right 1036905806 8:12707621-12707643 ATATGGTTTTTAATATCCAGGGG No data
1036905799_1036905800 -7 Left 1036905799 8:12707588-12707610 CCAACATCGAAGTGTGTGTACAC No data
Right 1036905800 8:12707604-12707626 TGTACACGCCCCTTGTGATATGG No data
1036905799_1036905805 9 Left 1036905799 8:12707588-12707610 CCAACATCGAAGTGTGTGTACAC No data
Right 1036905805 8:12707620-12707642 GATATGGTTTTTAATATCCAGGG No data
1036905799_1036905807 11 Left 1036905799 8:12707588-12707610 CCAACATCGAAGTGTGTGTACAC No data
Right 1036905807 8:12707622-12707644 TATGGTTTTTAATATCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036905799 Original CRISPR GTGTACACACACTTCGATGT TGG (reversed) Intergenic
No off target data available for this crispr