ID: 1036910061

View in Genome Browser
Species Human (GRCh38)
Location 8:12750920-12750942
Sequence CTGGGCATTTACTCTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036910057_1036910061 29 Left 1036910057 8:12750868-12750890 CCTTCTAGCCGTAACACACTTCT 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1036910061 8:12750920-12750942 CTGGGCATTTACTCTGTGTCAGG No data
1036910058_1036910061 21 Left 1036910058 8:12750876-12750898 CCGTAACACACTTCTACATTTTA 0: 1
1: 0
2: 3
3: 27
4: 345
Right 1036910061 8:12750920-12750942 CTGGGCATTTACTCTGTGTCAGG No data
1036910056_1036910061 30 Left 1036910056 8:12750867-12750889 CCCTTCTAGCCGTAACACACTTC 0: 1
1: 0
2: 2
3: 4
4: 56
Right 1036910061 8:12750920-12750942 CTGGGCATTTACTCTGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036910061 Original CRISPR CTGGGCATTTACTCTGTGTC AGG Intronic
No off target data available for this crispr