ID: 1036910189

View in Genome Browser
Species Human (GRCh38)
Location 8:12752361-12752383
Sequence CAGAGCTAACAAATTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036910189 Original CRISPR CAGAGCTAACAAATTAGAGT TGG (reversed) Intronic
903098330 1:21002558-21002580 CAAAGCTAACAAATAATAGTAGG + Intronic
910613944 1:89176661-89176683 CAGAGCTACTAAATAAGATTTGG + Intergenic
913678796 1:121168583-121168605 CTGAGGTAACTAATTAGAGACGG + Exonic
916661993 1:166931070-166931092 CAAGGCTAATAAATTAGAGGAGG - Intronic
918638004 1:186802933-186802955 GAGAGCTAAGGAATCAGAGTGGG - Intergenic
920466094 1:206187121-206187143 CTGAGGTAACTAATTAGAGACGG + Exonic
920504122 1:206504736-206504758 TTGAGCCAAGAAATTAGAGTTGG - Intergenic
923956287 1:239025428-239025450 CCGATCTGACAAATCAGAGTAGG - Intergenic
924045615 1:240026001-240026023 CTGAGACAACTAATTAGAGTTGG + Intronic
1063726478 10:8642797-8642819 CAGAGCCAACAAATGAGACATGG + Intergenic
1063748930 10:8920269-8920291 CAAAGGTAACAAATTATCGTAGG - Intergenic
1068650175 10:59513798-59513820 CAAATGTAGCAAATTAGAGTAGG + Intergenic
1070115335 10:73523431-73523453 CAGTGAGAACAAGTTAGAGTAGG - Intronic
1070365565 10:75733552-75733574 CAGAGCAAACAAAAATGAGTGGG + Intronic
1074961167 10:118447525-118447547 CAGAGCCAACAAATCTGAGCCGG + Intergenic
1075005105 10:118824549-118824571 CAGAGCCAACAAATGAGACATGG + Intergenic
1077772695 11:5237579-5237601 CAGAGGTTAGAAATCAGAGTTGG + Intergenic
1078544727 11:12239175-12239197 CAGGGATAAGAAATGAGAGTCGG + Intronic
1080320183 11:30999271-30999293 CAGAACTAATAAATCAGAGTTGG - Intronic
1080321127 11:31010478-31010500 CTGTGCTAGCAAACTAGAGTGGG - Intronic
1085713370 11:78850888-78850910 CAGAGCTAACATGTGACAGTGGG + Intronic
1085937355 11:81164298-81164320 CAGAATTAACAAATTACAATAGG + Intergenic
1085992833 11:81871258-81871280 TAGTGCTAACAGAGTAGAGTTGG - Intergenic
1086014186 11:82145504-82145526 CTGAGCTTACTTATTAGAGTAGG - Intergenic
1087029135 11:93684762-93684784 CAGAGCTAGCCAATGAGATTTGG - Intronic
1088772193 11:113046103-113046125 CACAGCAATCAAATTAGTGTAGG - Intronic
1089225854 11:116920969-116920991 AACAGCTACCAAATTATAGTTGG - Intronic
1089827928 11:121295750-121295772 CAGAGCTAGCAGATTTGGGTAGG - Intronic
1089947547 11:122493064-122493086 CAGAGCTAACTAAGTGGACTTGG - Intergenic
1091314479 11:134603162-134603184 CAGAGCTGATACATTTGAGTAGG + Intergenic
1091511056 12:1126617-1126639 CAAAGCTAACAGATGAGATTGGG + Intronic
1093562497 12:20558985-20559007 AAGAGCTCACAAATTATGGTTGG + Intronic
1093650032 12:21632649-21632671 CAGAGGAAAAAAGTTAGAGTTGG + Intergenic
1095543423 12:43338212-43338234 TACACCTAACAAATAAGAGTGGG - Intergenic
1095577998 12:43761118-43761140 CAGAGCTATTAAATTAGATAGGG - Intronic
1095669815 12:44845678-44845700 CAAAGCTAACAATTAAGATTTGG + Intronic
1096889349 12:54751386-54751408 CAGTGCTTACAAATAAAAGTAGG + Intergenic
1097322150 12:58237845-58237867 CAGAGGCAACAAATTAAAATAGG - Intergenic
1097915136 12:65013255-65013277 CAGACCAAACATATTAGAGGAGG - Intergenic
1101329923 12:103749396-103749418 CAGAGCTAAGAAATTAATGTTGG - Intronic
1106671072 13:31906047-31906069 CAGAGCTGCCAAATTTGAGCAGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112387444 13:98952954-98952976 CAGAGGGAACAAATTAGATTGGG - Intronic
1113150679 13:107260538-107260560 CAGAGCTGGAAAATCAGAGTGGG - Intronic
1115244887 14:31285068-31285090 AAGAGTTAACAAATTAGGCTGGG + Intergenic
1116365357 14:44054480-44054502 CAGAACTACAAAATTAGAGCGGG + Intergenic
1116400562 14:44501125-44501147 AAGAGCTAATAAATGAGATTGGG + Intergenic
1116640348 14:47454226-47454248 CAGACATCAAAAATTAGAGTTGG - Intronic
1117321291 14:54625871-54625893 AAGAGATACCAAATTAGAGCGGG - Intronic
1118128370 14:62935099-62935121 CAGAGCTAATAACTTAGTTTAGG - Intronic
1118173448 14:63412544-63412566 CAAAACTAACAAATGAGAGAAGG + Intronic
1119898501 14:78240599-78240621 CAGAGCTGACAAATGAGAAATGG - Intergenic
1124040801 15:26101393-26101415 CATAGGTAATAGATTAGAGTTGG - Intergenic
1124805640 15:32879389-32879411 AAGAGCTAATAAATTAGACATGG + Intronic
1125342363 15:38687573-38687595 CAGAGCAAACAAAGAAGATTAGG - Intergenic
1128311253 15:66632886-66632908 CAGAGCTGACAAAATAGATGGGG - Intronic
1128787529 15:70409189-70409211 CAGATCCAATCAATTAGAGTTGG - Intergenic
1130549892 15:84883713-84883735 AAGAGCTAAGAAATGAGTGTGGG + Intergenic
1130903791 15:88226165-88226187 CAGAGCTAAGGACTTAGAGACGG - Intronic
1132002535 15:98194386-98194408 CAGAGCTACAGAATCAGAGTTGG - Intergenic
1134283802 16:12842478-12842500 CAGAGGAAACAAATTGAAGTAGG - Intergenic
1135461689 16:22649482-22649504 CAGAGAAAACGAGTTAGAGTGGG - Intergenic
1140903957 16:79394748-79394770 CAGACCTAAAAAATTGGAGTAGG - Intergenic
1142484201 17:236206-236228 CAGAGGTAGGACATTAGAGTGGG - Intronic
1147930249 17:43975303-43975325 CACAGCTAAGAAATGCGAGTGGG - Intronic
1148842005 17:50504815-50504837 ATGAGCTCACACATTAGAGTTGG + Intergenic
1149837513 17:59926856-59926878 CAGAGCCATCAAATTGTAGTGGG + Intronic
1149852967 17:60052160-60052182 TAGACCTAGCAAATTAGTGTTGG - Intronic
1149946265 17:60931069-60931091 CACAGCTAATAAATAAGAATGGG - Intronic
1150953793 17:69832454-69832476 ATGAGCTAACAAATTGGAGACGG + Intergenic
1151923735 17:77177956-77177978 CAGAGCTGTCAAATTAGGTTTGG + Intronic
1153621019 18:6977877-6977899 CAGAGCTAACAAATACAAGAAGG + Exonic
1156846046 18:41666195-41666217 CAGAGATAACAAATTTGAGAAGG + Intergenic
1157882036 18:51329754-51329776 CAGAGCTAGTAAATTGGTGTGGG - Intergenic
1158080044 18:53579231-53579253 CAGAGCAAACAATTTAGAACAGG + Intergenic
1160258860 18:77272173-77272195 CAGATATAACAAATCAGAGTGGG + Exonic
1163880003 19:19911144-19911166 AAGAGCTAGCAAATCAGAATGGG + Intronic
1163912740 19:20211659-20211681 TGGAGCTAGCAAATTAGAATAGG - Intergenic
1164741290 19:30577429-30577451 CAGAGATAGTAAATTAGAGTAGG + Intronic
1165238428 19:34442889-34442911 CAGAGCTTTGAAATTATAGTTGG + Intronic
926722885 2:15975182-15975204 GAAAGCTAACAAATTTGTGTTGG - Intergenic
929745691 2:44655711-44655733 CAGAGCTATCCAATTAGAAAAGG + Intronic
929842537 2:45484434-45484456 CACAGCTTACAAATGAGAGTGGG - Intronic
933345153 2:81075111-81075133 TAGAGCCAAAAAATTAGATTTGG + Intergenic
934930321 2:98416955-98416977 CAGATATAACTAGTTAGAGTGGG + Intergenic
936415594 2:112306979-112307001 GACAGCTAACAAATTAGTGAAGG - Intronic
937219367 2:120332972-120332994 AAGAGCTATCACAGTAGAGTGGG - Intergenic
937498862 2:122455543-122455565 AAGAGCTACCAAAGTAGAGCTGG + Intergenic
938993203 2:136650742-136650764 CAGGGCTAACAAAATAGACTTGG - Intergenic
941826939 2:169909160-169909182 CAGAGTAAACAAGTTGGAGTTGG + Intronic
942669650 2:178361023-178361045 CATACCTAACAAATTAGCATTGG - Intronic
944454951 2:199883763-199883785 CAGGGCTATCAATTGAGAGTAGG - Intergenic
944787973 2:203093300-203093322 CAATGCTAACAAATTTTAGTAGG - Intronic
944949544 2:204731862-204731884 CAGAGCTAAGAAATTAGTAGAGG - Intronic
1170167154 20:13373031-13373053 GAGAGATAACAAAGAAGAGTAGG + Intergenic
1170735334 20:19009304-19009326 AAGAGATCACAAGTTAGAGTCGG - Intergenic
1175082021 20:56428709-56428731 AAGAGTTAGCAGATTAGAGTAGG + Intronic
1175348260 20:58298834-58298856 GAGAGCTAATAAATCAGTGTGGG - Intergenic
1177740022 21:25143202-25143224 AAAAGCTAACAAAATACAGTAGG - Intergenic
1177872488 21:26590291-26590313 CTGAGCTAAAAAATTAGTGATGG + Intergenic
1181968767 22:26674567-26674589 CAGAGCTAACCAATTGTAGTTGG + Intergenic
1183123941 22:35756535-35756557 AAGAGCTTACAAAGTAGGGTAGG + Intronic
1185276523 22:49952293-49952315 CAGAGCTGACACAGAAGAGTGGG + Intergenic
950841406 3:15971707-15971729 CAAAGCAAACAAAATAAAGTGGG + Intergenic
951503108 3:23412812-23412834 CAGAATTAACAACTTTGAGTGGG + Intronic
951874041 3:27400865-27400887 CACATCTGAGAAATTAGAGTAGG + Exonic
952979694 3:38724669-38724691 CAGAGCCAGCAAATAAGAGTTGG - Intronic
953653853 3:44832374-44832396 CAGAGCTAAGAAATGCTAGTGGG + Intronic
954362574 3:50129954-50129976 CAGAGCTAGCAAATCAGACATGG - Intergenic
956309014 3:67858611-67858633 AAGAGTTGACAAATTAGGGTAGG + Intergenic
956382543 3:68680564-68680586 CTGAGCTAACCAATTACAGATGG - Intergenic
960857790 3:122120776-122120798 TAGGGCTAGCAAATTTGAGTTGG + Exonic
964705282 3:159611735-159611757 CATATGTAAAAAATTAGAGTGGG - Intronic
971709883 4:30097308-30097330 CAAAGCTTACAATTTAGTGTGGG - Intergenic
973895623 4:55409866-55409888 CAGAACTAAAAAGTTAGAGATGG - Intronic
974260027 4:59515399-59515421 CAAAGCTGACATATTAGAGCTGG + Intergenic
975025694 4:69545937-69545959 CAGAGCTAAGAAAATAAATTAGG - Intergenic
975900785 4:79149559-79149581 CAGAGCCAAAAAATAAGAGAGGG - Intergenic
976928953 4:90539250-90539272 CAAAACTAACAAATGAGTGTAGG + Intronic
977767639 4:100818974-100818996 CATAGTTAACAAATGAGAGTGGG - Intronic
979234671 4:118386188-118386210 CAGAGATAATAAAATAGAATAGG + Intergenic
979274957 4:118805117-118805139 CAGAGCTAACCTTATAGAGTGGG - Intronic
980284317 4:130762344-130762366 CATATCTTATAAATTAGAGTAGG - Intergenic
980541105 4:134197207-134197229 GAGAGCCAATGAATTAGAGTTGG - Exonic
983270218 4:165552297-165552319 CAAAGCTAACAAATCAAAGCAGG - Intergenic
985156251 4:186990282-186990304 CAGAACTTACAAATTAAATTGGG + Intergenic
985953304 5:3239798-3239820 TAAATCTAACAAATTAGAGAGGG + Intergenic
986850606 5:11808345-11808367 CAGAGCTGACAGTCTAGAGTGGG + Intronic
987183418 5:15389334-15389356 CAGAGCTAAGATTTCAGAGTAGG + Intergenic
987303842 5:16619360-16619382 CAGAGATAATAAATAAGTGTTGG - Intergenic
989806924 5:45620341-45620363 CAAATCTAAGAAATTAGATTGGG - Intronic
990493990 5:56328626-56328648 TAGAGCTAACAATTTAGTGGAGG - Intergenic
992653646 5:78886617-78886639 CAGAGTTAAGACATTAAAGTGGG + Intronic
992967329 5:82016348-82016370 CAAAGCAAACAAAATAAAGTGGG - Intronic
994758527 5:103824473-103824495 AAGAGCTAAGAAATTATAGATGG + Intergenic
995562199 5:113394710-113394732 AAGAGCTATCAAATTAGACTGGG - Intronic
998748393 5:145288771-145288793 CAACTCTAACAGATTAGAGTTGG - Intergenic
1000036802 5:157455050-157455072 CAGAGCCAGCAAATGAGAGGTGG + Intronic
1001093983 5:168762070-168762092 AAGAGCTAAAAAATTATAGCTGG - Intronic
1003361786 6:5433464-5433486 AAGAGGTAACAAATTACACTTGG - Intronic
1007452008 6:41947290-41947312 CAGCACTACCAAATCAGAGTTGG + Intronic
1009790452 6:68394795-68394817 TAGAGATAACAAATTGTAGTTGG - Intergenic
1011345749 6:86368342-86368364 CAGAGCAAAGGAATTAAAGTTGG + Intergenic
1012027763 6:94019681-94019703 CAGAGCCACCAAAGTAGAGATGG - Intergenic
1012559672 6:100565083-100565105 CAGTCCAACCAAATTAGAGTTGG + Intronic
1013837707 6:114352050-114352072 AAGAGCTATAAAATTAGACTGGG + Intergenic
1013961854 6:115910372-115910394 CAGAGCTAACAACTTCCAGAGGG - Intergenic
1015180166 6:130353219-130353241 CAGAGCTATCAAATAAAAGCTGG - Intronic
1015861134 6:137681398-137681420 CAGAGCTAAGAAATTCAAGGTGG - Intergenic
1016724200 6:147341983-147342005 CACAGCTAATAAATGAGAGCAGG + Intronic
1023586265 7:41733218-41733240 CACAGCTTAGAAATCAGAGTCGG - Intergenic
1026112176 7:67467062-67467084 CAGAGAAAACAAGTAAGAGTAGG - Intergenic
1026969436 7:74458976-74458998 GAGAGCTACCAAAATAGGGTGGG - Intronic
1029628339 7:101734350-101734372 CACAGCTAATAAATCAGAGGCGG + Intergenic
1033672524 7:143506567-143506589 CAGAGCAAATAAATGAGAGCTGG + Intergenic
1035596232 8:860234-860256 CACAGCTTAGAAATTAGAATGGG + Intergenic
1036151037 8:6298812-6298834 TACAGCTAAAAAATTAGTGTGGG - Intergenic
1036910189 8:12752361-12752383 CAGAGCTAACAAATTAGAGTTGG - Intronic
1037180461 8:15998992-15999014 CCGAGCTGATAAATCAGAGTAGG - Intergenic
1044255535 8:90056206-90056228 CAGAGCTAACAAATAAATGGTGG - Intergenic
1044776760 8:95697653-95697675 TATAACTAACAAATTAGAGAAGG + Intergenic
1046360434 8:113146637-113146659 CAGAATGAACAAATTTGAGTGGG + Intronic
1048873605 8:138818567-138818589 CAGAGCCAACAAATGGCAGTTGG - Intronic
1057054694 9:91951214-91951236 CAGAGGTAACAAGCTAGAGCTGG - Intergenic
1060154409 9:121309207-121309229 CAGAGTTGTCAAATCAGAGTTGG - Intronic
1188368638 X:29341466-29341488 CAGAGGGAACAATTTAGTGTTGG + Intronic
1188859528 X:35240712-35240734 CAAAGCAAACAAATAAGAGTAGG - Intergenic
1189130432 X:38492520-38492542 CAGAGCTGACACATGAGATTTGG - Intronic
1196438107 X:115693027-115693049 CAGAGCCAGCAAATGAGACTTGG + Intergenic
1196822392 X:119712453-119712475 AAGGTCTAACAAATTAGATTTGG + Intergenic