ID: 1036911311

View in Genome Browser
Species Human (GRCh38)
Location 8:12759513-12759535
Sequence GTAAATGGTACTTGGTTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036911311_1036911318 22 Left 1036911311 8:12759513-12759535 CCATCTAACCAAGTACCATTTAC No data
Right 1036911318 8:12759558-12759580 CAGGGTGCACAAAGTGCGCAAGG No data
1036911311_1036911319 23 Left 1036911311 8:12759513-12759535 CCATCTAACCAAGTACCATTTAC No data
Right 1036911319 8:12759559-12759581 AGGGTGCACAAAGTGCGCAAGGG No data
1036911311_1036911315 4 Left 1036911311 8:12759513-12759535 CCATCTAACCAAGTACCATTTAC No data
Right 1036911315 8:12759540-12759562 CATTCTTTGTTATCCCTACAGGG No data
1036911311_1036911314 3 Left 1036911311 8:12759513-12759535 CCATCTAACCAAGTACCATTTAC No data
Right 1036911314 8:12759539-12759561 TCATTCTTTGTTATCCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036911311 Original CRISPR GTAAATGGTACTTGGTTAGA TGG (reversed) Intergenic
No off target data available for this crispr