ID: 1036911312

View in Genome Browser
Species Human (GRCh38)
Location 8:12759521-12759543
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036911312_1036911318 14 Left 1036911312 8:12759521-12759543 CCAAGTACCATTTACTGCTCATT No data
Right 1036911318 8:12759558-12759580 CAGGGTGCACAAAGTGCGCAAGG No data
1036911312_1036911314 -5 Left 1036911312 8:12759521-12759543 CCAAGTACCATTTACTGCTCATT No data
Right 1036911314 8:12759539-12759561 TCATTCTTTGTTATCCCTACAGG No data
1036911312_1036911319 15 Left 1036911312 8:12759521-12759543 CCAAGTACCATTTACTGCTCATT No data
Right 1036911319 8:12759559-12759581 AGGGTGCACAAAGTGCGCAAGGG No data
1036911312_1036911315 -4 Left 1036911312 8:12759521-12759543 CCAAGTACCATTTACTGCTCATT No data
Right 1036911315 8:12759540-12759562 CATTCTTTGTTATCCCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036911312 Original CRISPR AATGAGCAGTAAATGGTACT TGG (reversed) Intergenic
No off target data available for this crispr