ID: 1036911313

View in Genome Browser
Species Human (GRCh38)
Location 8:12759528-12759550
Sequence AACAAAGAATGAGCAGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036911313_1036911319 8 Left 1036911313 8:12759528-12759550 CCATTTACTGCTCATTCTTTGTT No data
Right 1036911319 8:12759559-12759581 AGGGTGCACAAAGTGCGCAAGGG No data
1036911313_1036911321 27 Left 1036911313 8:12759528-12759550 CCATTTACTGCTCATTCTTTGTT No data
Right 1036911321 8:12759578-12759600 AGGGCCACTACCCTTACAAAGGG No data
1036911313_1036911318 7 Left 1036911313 8:12759528-12759550 CCATTTACTGCTCATTCTTTGTT No data
Right 1036911318 8:12759558-12759580 CAGGGTGCACAAAGTGCGCAAGG No data
1036911313_1036911320 26 Left 1036911313 8:12759528-12759550 CCATTTACTGCTCATTCTTTGTT No data
Right 1036911320 8:12759577-12759599 AAGGGCCACTACCCTTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036911313 Original CRISPR AACAAAGAATGAGCAGTAAA TGG (reversed) Intergenic
No off target data available for this crispr