ID: 1036911319

View in Genome Browser
Species Human (GRCh38)
Location 8:12759559-12759581
Sequence AGGGTGCACAAAGTGCGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036911311_1036911319 23 Left 1036911311 8:12759513-12759535 CCATCTAACCAAGTACCATTTAC No data
Right 1036911319 8:12759559-12759581 AGGGTGCACAAAGTGCGCAAGGG No data
1036911313_1036911319 8 Left 1036911313 8:12759528-12759550 CCATTTACTGCTCATTCTTTGTT No data
Right 1036911319 8:12759559-12759581 AGGGTGCACAAAGTGCGCAAGGG No data
1036911312_1036911319 15 Left 1036911312 8:12759521-12759543 CCAAGTACCATTTACTGCTCATT No data
Right 1036911319 8:12759559-12759581 AGGGTGCACAAAGTGCGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036911319 Original CRISPR AGGGTGCACAAAGTGCGCAA GGG Intergenic
No off target data available for this crispr