ID: 1036911320

View in Genome Browser
Species Human (GRCh38)
Location 8:12759577-12759599
Sequence AAGGGCCACTACCCTTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036911313_1036911320 26 Left 1036911313 8:12759528-12759550 CCATTTACTGCTCATTCTTTGTT No data
Right 1036911320 8:12759577-12759599 AAGGGCCACTACCCTTACAAAGG No data
1036911316_1036911320 1 Left 1036911316 8:12759553-12759575 CCCTACAGGGTGCACAAAGTGCG No data
Right 1036911320 8:12759577-12759599 AAGGGCCACTACCCTTACAAAGG No data
1036911317_1036911320 0 Left 1036911317 8:12759554-12759576 CCTACAGGGTGCACAAAGTGCGC No data
Right 1036911320 8:12759577-12759599 AAGGGCCACTACCCTTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036911320 Original CRISPR AAGGGCCACTACCCTTACAA AGG Intergenic
No off target data available for this crispr