ID: 1036911754

View in Genome Browser
Species Human (GRCh38)
Location 8:12763376-12763398
Sequence CTGTATCCCCACATGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036911749_1036911754 9 Left 1036911749 8:12763344-12763366 CCTATTTCCTGTTTATAGAGGGT No data
Right 1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG No data
1036911751_1036911754 2 Left 1036911751 8:12763351-12763373 CCTGTTTATAGAGGGTGCCTGGT No data
Right 1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036911754 Original CRISPR CTGTATCCCCACATGGAAGA AGG Intergenic
No off target data available for this crispr