ID: 1036911963

View in Genome Browser
Species Human (GRCh38)
Location 8:12765209-12765231
Sequence GGGTGCGTTTATGCAGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036911962_1036911963 -6 Left 1036911962 8:12765192-12765214 CCTCTTTATAGAGCTCAGGGTGC No data
Right 1036911963 8:12765209-12765231 GGGTGCGTTTATGCAGTTTGTGG No data
1036911960_1036911963 -4 Left 1036911960 8:12765190-12765212 CCCCTCTTTATAGAGCTCAGGGT No data
Right 1036911963 8:12765209-12765231 GGGTGCGTTTATGCAGTTTGTGG No data
1036911961_1036911963 -5 Left 1036911961 8:12765191-12765213 CCCTCTTTATAGAGCTCAGGGTG No data
Right 1036911963 8:12765209-12765231 GGGTGCGTTTATGCAGTTTGTGG No data
1036911957_1036911963 16 Left 1036911957 8:12765170-12765192 CCTCTGCGAAGTGAAATCAGCCC No data
Right 1036911963 8:12765209-12765231 GGGTGCGTTTATGCAGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036911963 Original CRISPR GGGTGCGTTTATGCAGTTTG TGG Intergenic
No off target data available for this crispr