ID: 1036913893

View in Genome Browser
Species Human (GRCh38)
Location 8:12785867-12785889
Sequence ACGATTGCAGGTGTGTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036913886_1036913893 26 Left 1036913886 8:12785818-12785840 CCTTTACTAAGCACTGGGCTTTT No data
Right 1036913893 8:12785867-12785889 ACGATTGCAGGTGTGTGTTATGG No data
1036913890_1036913893 -2 Left 1036913890 8:12785846-12785868 CCGAGTGGCTTTCCTGTCACTAC No data
Right 1036913893 8:12785867-12785889 ACGATTGCAGGTGTGTGTTATGG No data
1036913885_1036913893 27 Left 1036913885 8:12785817-12785839 CCCTTTACTAAGCACTGGGCTTT No data
Right 1036913893 8:12785867-12785889 ACGATTGCAGGTGTGTGTTATGG No data
1036913889_1036913893 -1 Left 1036913889 8:12785845-12785867 CCCGAGTGGCTTTCCTGTCACTA No data
Right 1036913893 8:12785867-12785889 ACGATTGCAGGTGTGTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036913893 Original CRISPR ACGATTGCAGGTGTGTGTTA TGG Intergenic
No off target data available for this crispr