ID: 1036915410

View in Genome Browser
Species Human (GRCh38)
Location 8:12799485-12799507
Sequence GAGGTACGTGAACAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036915402_1036915410 21 Left 1036915402 8:12799441-12799463 CCATTTGCAGGGTTCCAAGGTCT No data
Right 1036915410 8:12799485-12799507 GAGGTACGTGAACAAGTGGAGGG No data
1036915400_1036915410 26 Left 1036915400 8:12799436-12799458 CCTTGCCATTTGCAGGGTTCCAA No data
Right 1036915410 8:12799485-12799507 GAGGTACGTGAACAAGTGGAGGG No data
1036915406_1036915410 -5 Left 1036915406 8:12799467-12799489 CCTGCATCCAGGAAGAATGAGGT 0: 108
1: 376
2: 562
3: 638
4: 769
Right 1036915410 8:12799485-12799507 GAGGTACGTGAACAAGTGGAGGG No data
1036915403_1036915410 7 Left 1036915403 8:12799455-12799477 CCAAGGTCTCGTCCTGCATCCAG No data
Right 1036915410 8:12799485-12799507 GAGGTACGTGAACAAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036915410 Original CRISPR GAGGTACGTGAACAAGTGGA GGG Intergenic
No off target data available for this crispr