ID: 1036917288

View in Genome Browser
Species Human (GRCh38)
Location 8:12816313-12816335
Sequence CAGTGCTTGGAGAAATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036917283_1036917288 27 Left 1036917283 8:12816263-12816285 CCACGATGGAGACGTAGTTCTGC No data
Right 1036917288 8:12816313-12816335 CAGTGCTTGGAGAAATCTCCAGG No data
1036917286_1036917288 -5 Left 1036917286 8:12816295-12816317 CCATTTCTGTGCTTATGTCAGTG No data
Right 1036917288 8:12816313-12816335 CAGTGCTTGGAGAAATCTCCAGG No data
1036917285_1036917288 -4 Left 1036917285 8:12816294-12816316 CCCATTTCTGTGCTTATGTCAGT No data
Right 1036917288 8:12816313-12816335 CAGTGCTTGGAGAAATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036917288 Original CRISPR CAGTGCTTGGAGAAATCTCC AGG Intergenic
No off target data available for this crispr