ID: 1036924945

View in Genome Browser
Species Human (GRCh38)
Location 8:12895414-12895436
Sequence ACCGGCACCCTGCTTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036924945_1036924947 6 Left 1036924945 8:12895414-12895436 CCAGTAACAAGCAGGGTGCCGGT No data
Right 1036924947 8:12895443-12895465 CGCCTGTAATCTGAGCACTTTGG 0: 103
1: 6683
2: 150060
3: 296460
4: 215179
1036924945_1036924950 16 Left 1036924945 8:12895414-12895436 CCAGTAACAAGCAGGGTGCCGGT No data
Right 1036924950 8:12895453-12895475 CTGAGCACTTTGGTAGGCCGAGG No data
1036924945_1036924949 10 Left 1036924945 8:12895414-12895436 CCAGTAACAAGCAGGGTGCCGGT No data
Right 1036924949 8:12895447-12895469 TGTAATCTGAGCACTTTGGTAGG No data
1036924945_1036924951 20 Left 1036924945 8:12895414-12895436 CCAGTAACAAGCAGGGTGCCGGT No data
Right 1036924951 8:12895457-12895479 GCACTTTGGTAGGCCGAGGCAGG 0: 303
1: 87893
2: 225534
3: 236346
4: 155975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036924945 Original CRISPR ACCGGCACCCTGCTTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr