ID: 1036924947

View in Genome Browser
Species Human (GRCh38)
Location 8:12895443-12895465
Sequence CGCCTGTAATCTGAGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 668485
Summary {0: 103, 1: 6683, 2: 150060, 3: 296460, 4: 215179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036924945_1036924947 6 Left 1036924945 8:12895414-12895436 CCAGTAACAAGCAGGGTGCCGGT No data
Right 1036924947 8:12895443-12895465 CGCCTGTAATCTGAGCACTTTGG 0: 103
1: 6683
2: 150060
3: 296460
4: 215179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036924947 Original CRISPR CGCCTGTAATCTGAGCACTT TGG Intergenic
Too many off-targets to display for this crispr