ID: 1036924949

View in Genome Browser
Species Human (GRCh38)
Location 8:12895447-12895469
Sequence TGTAATCTGAGCACTTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036924945_1036924949 10 Left 1036924945 8:12895414-12895436 CCAGTAACAAGCAGGGTGCCGGT No data
Right 1036924949 8:12895447-12895469 TGTAATCTGAGCACTTTGGTAGG No data
1036924946_1036924949 -8 Left 1036924946 8:12895432-12895454 CCGGTGACTCACGCCTGTAATCT No data
Right 1036924949 8:12895447-12895469 TGTAATCTGAGCACTTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036924949 Original CRISPR TGTAATCTGAGCACTTTGGT AGG Intergenic
No off target data available for this crispr