ID: 1036924951

View in Genome Browser
Species Human (GRCh38)
Location 8:12895457-12895479
Sequence GCACTTTGGTAGGCCGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 706051
Summary {0: 303, 1: 87893, 2: 225534, 3: 236346, 4: 155975}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036924945_1036924951 20 Left 1036924945 8:12895414-12895436 CCAGTAACAAGCAGGGTGCCGGT No data
Right 1036924951 8:12895457-12895479 GCACTTTGGTAGGCCGAGGCAGG 0: 303
1: 87893
2: 225534
3: 236346
4: 155975
1036924946_1036924951 2 Left 1036924946 8:12895432-12895454 CCGGTGACTCACGCCTGTAATCT No data
Right 1036924951 8:12895457-12895479 GCACTTTGGTAGGCCGAGGCAGG 0: 303
1: 87893
2: 225534
3: 236346
4: 155975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036924951 Original CRISPR GCACTTTGGTAGGCCGAGGC AGG Intergenic
Too many off-targets to display for this crispr