ID: 1036930213

View in Genome Browser
Species Human (GRCh38)
Location 8:12949542-12949564
Sequence CTAGTTGAGGCCATCATAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036930213_1036930217 25 Left 1036930213 8:12949542-12949564 CCGCTTATGATGGCCTCAACTAG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1036930217 8:12949590-12949612 CCTCCAAACAAGAAAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036930213 Original CRISPR CTAGTTGAGGCCATCATAAG CGG (reversed) Intronic
913442997 1:118919025-118919047 CTAGTTTAGACCATAATGAGTGG + Intronic
915472090 1:156131757-156131779 TTTATTGAGGCCATCAGAAGCGG + Intronic
917374809 1:174339471-174339493 CTAATTCAGGCTATCATAAGTGG + Intronic
920061039 1:203227148-203227170 CTAGTTGAGGCCTGCCTGAGCGG - Intronic
921105461 1:211972727-211972749 TCAGTTGAGGCCATTAAAAGAGG + Intronic
922758837 1:228111702-228111724 CTGGTTCAGGCCATAAGAAGTGG - Intergenic
924903901 1:248432095-248432117 CTACTTGAGACCATCATTACAGG - Intergenic
1063417724 10:5888041-5888063 CTTGTGCAGGCCATCATCAGAGG + Exonic
1064939099 10:20712972-20712994 CTAGTTCAGGCCATGATGTGGGG - Intergenic
1067902953 10:50261598-50261620 CTACTTCAATCCATCATAAGGGG + Intergenic
1068800118 10:61131231-61131253 GTAGGTGAGGAGATCATAAGAGG - Intergenic
1073633150 10:105169121-105169143 CTTTTTGATGCCATTATAAGTGG - Intronic
1074997565 10:118770893-118770915 CTAGTTCAGGCCATGATGGGAGG + Intergenic
1075634958 10:124024258-124024280 CTAATTGAGGTCATGATATGAGG + Intronic
1081035466 11:38138962-38138984 CTTTTTGAGGCTATTATAAGTGG - Intergenic
1096363173 12:51005910-51005932 CTAGTTCAGGCCATGATGGGAGG + Intronic
1096566819 12:52488873-52488895 CTATATGAGGTAATCATAAGTGG - Intronic
1102076941 12:110067187-110067209 CTAGGTGGTGCCATCGTAAGCGG + Intronic
1111170586 13:84521776-84521798 CTAGTTGAGGTAATAATAATTGG - Intergenic
1114201659 14:20526505-20526527 CTAGTAGAGGACACCATTAGAGG - Intergenic
1118231238 14:63951974-63951996 CTAGTTTTGGCCATCATTGGTGG + Intronic
1127644868 15:60947902-60947924 CTATTTGTGGGCATCAGAAGTGG + Intronic
1133822135 16:9246266-9246288 CTTGTTTAGGCCATCCAAAGTGG + Intergenic
1134760981 16:16714921-16714943 TTAATTGTGGCCATCATAATGGG + Intergenic
1134985077 16:18644255-18644277 TTAATTGTGGCCATCATAATGGG - Intergenic
1136640991 16:31564933-31564955 CTTATTGAGGCCATGATGAGTGG - Intergenic
1141344707 16:83234052-83234074 CTATTTGAAGCCAGCAGAAGAGG - Intronic
1141471380 16:84240891-84240913 ATAGTTGAGGCCCTGAGAAGAGG + Intergenic
1145358961 17:22195362-22195384 CTACTTCAGGCAATCAGAAGAGG - Intergenic
1146328500 17:31907402-31907424 CTAGTTTGAGCCATAATAAGAGG + Intergenic
1154413695 18:14160213-14160235 CTTTTTGATGCTATCATAAGTGG - Intergenic
1156523753 18:37746686-37746708 CTGGTTGAGGCCTCCAGAAGTGG + Intergenic
1157228997 18:45896118-45896140 CTAGTTGAGGCTATCCCAGGCGG - Intronic
1162968688 19:14167595-14167617 CTGGGTGAGGCCAGCATAAAGGG - Intronic
1167779984 19:51592984-51593006 ACAGTTGATGCCATCATCAGAGG + Intergenic
924997001 2:370731-370753 CTTTTTGAGGCTATCATAAATGG + Intergenic
927421900 2:22942814-22942836 CTAGTGGAGCCCATCACAGGGGG + Intergenic
930749121 2:54915450-54915472 TTAGGTTAGGACATCATAAGGGG + Intronic
933228621 2:79779879-79779901 CTAGTTCAGGCCATGATGGGAGG + Intronic
935405043 2:102699937-102699959 TAAGTTGAGGCCATCAAAATGGG - Intronic
935463496 2:103366944-103366966 CTGGTTGAGGTCTTCACAAGTGG - Intergenic
945021432 2:205576052-205576074 CTAATTGTGGCCATCCTAATAGG + Intronic
947949715 2:234136565-234136587 CTAGTTCAGGCCATGATGGGAGG + Intergenic
1175682355 20:60998983-60999005 CTAGCTGAGCTCATTATAAGAGG - Intergenic
1178674560 21:34620210-34620232 CCTGTTGAGGCCATCAGAGGTGG + Intergenic
1182934085 22:34204403-34204425 CTTTTTGATGCTATCATAAGTGG - Intergenic
951586688 3:24222127-24222149 CTAGTTTCTGCCATAATAAGGGG - Intronic
954945370 3:54419518-54419540 ATACTTGTGGCAATCATAAGAGG - Intronic
956030272 3:65029755-65029777 CTGGTTGAGGCAATTATATGAGG - Intergenic
961470866 3:127111111-127111133 CTAGTTCAGGCCATGATGGGAGG + Intergenic
966822977 3:183939886-183939908 CTCGATGAGGCCCTCACAAGAGG - Intronic
975026804 4:69559130-69559152 GTGGTGGTGGCCATCATAAGAGG + Intergenic
980470601 4:133246225-133246247 CTAGTTGTGGCTATTATTAGTGG - Intergenic
982951524 4:161702992-161703014 CTAGTTGATGTCCTTATAAGAGG + Intronic
984601828 4:181736665-181736687 CTAGTTGAGGCCAGGATTATTGG - Intergenic
988190894 5:27932805-27932827 ATAGTTGAAGCCATCACAATAGG - Intergenic
992151923 5:73913529-73913551 CTAGCTAAGGCCATCACCAGTGG - Intronic
992167409 5:74068362-74068384 CTAGGTGAGGCCATAATGACTGG - Intergenic
995893102 5:116979112-116979134 CTAGATAAGGCCATCTTGAGAGG + Intergenic
997620171 5:135283693-135283715 CTTTTTGTGGCTATCATAAGTGG + Intronic
998026721 5:138823295-138823317 CAAGTAGATGCCATCATTAGTGG + Intronic
998661964 5:144248659-144248681 CTACTTGAAGCCATGATAATAGG + Intronic
999370798 5:151054037-151054059 CTAGTTCTGGCCAACAAAAGAGG + Intronic
1001493733 5:172173507-172173529 GTAGTTGAGGGCACCAGAAGTGG - Intronic
1003304661 6:4915468-4915490 CTAGTTCAGGCCATAATGTGGGG + Intronic
1003398091 6:5770301-5770323 CTGGTTGACGGCATCATAAAAGG + Intronic
1004223348 6:13765646-13765668 CCAGCTGAGGCCATCATCTGTGG + Intergenic
1009348102 6:62642330-62642352 CTTGATGAGGCCAGCATAAAAGG - Intergenic
1018752618 6:166820825-166820847 ATAATTGAGGTCATTATAAGTGG - Intronic
1019264804 7:108941-108963 TTAGTTGAGGCCATCTTAACTGG - Intergenic
1020829474 7:13075871-13075893 CTCTTTGGGGCTATCATAAGTGG - Intergenic
1022970422 7:35511813-35511835 GTAGTTGAGCTCATCAGAAGAGG - Intergenic
1031256235 7:119452104-119452126 CTAGTTGAGGAAATGAGAAGAGG + Intergenic
1032818489 7:135501910-135501932 AGAGTTGAGGCCATTAAAAGAGG + Intronic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1036930213 8:12949542-12949564 CTAGTTGAGGCCATCATAAGCGG - Intronic
1041181205 8:55250465-55250487 CTAATTTAGGGCTTCATAAGAGG + Intronic
1044340249 8:91039061-91039083 CTAGTTGAGGGCATGAAAATAGG + Intronic
1046310998 8:112438234-112438256 CTAGTTGTTGCCATTTTAAGAGG + Intronic
1046466386 8:114609366-114609388 CTACTTGATGATATCATAAGTGG + Intergenic
1048052784 8:130835124-130835146 CTAGCTGAGGCCAGAATAAGTGG - Intronic
1048270004 8:133020917-133020939 CTGTCTGAGGCCATCATATGTGG + Intronic
1048727643 8:137404980-137405002 ATAGTTGGGGCAATCCTAAGGGG + Intergenic
1049531715 8:143158613-143158635 CTAGTTGAGGCCAGCGTGGGAGG - Intronic
1060246956 9:121954739-121954761 CTAGTTGAGGGCAGCTTAATTGG - Intronic
1060899051 9:127241500-127241522 CTAGTTGCTGCCAAGATAAGTGG + Intronic
1061315139 9:129790726-129790748 CTCGTCGAGGCCATCATAAATGG - Intergenic
1203625095 Un_KI270750v1:9867-9889 CTAGTTAAAGCAATTATAAGTGG + Intergenic
1188973129 X:36641424-36641446 TTTGTTGTAGCCATCATAAGTGG + Intergenic
1189221035 X:39372137-39372159 ATAGTTTAGGGCATCAAAAGGGG - Intergenic
1189750300 X:44213815-44213837 CTAGTTCAGGCCATGATGAGGGG - Intronic
1195672036 X:107477872-107477894 CTGGCTGAGGCCATAATAGGGGG - Intergenic
1198576757 X:138018862-138018884 TTAGTAGAGGGCATAATAAGTGG - Intergenic