ID: 1036930639

View in Genome Browser
Species Human (GRCh38)
Location 8:12952123-12952145
Sequence CAGCGCTGTCCCGCAGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036930639_1036930644 24 Left 1036930639 8:12952123-12952145 CCCCTGGCTGCGGGACAGCGCTG 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1036930644 8:12952170-12952192 CTGCCAGTCGCCACACCGTGCGG 0: 1
1: 0
2: 0
3: 6
4: 71
1036930639_1036930643 -6 Left 1036930639 8:12952123-12952145 CCCCTGGCTGCGGGACAGCGCTG 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1036930643 8:12952140-12952162 GCGCTGTGACTACTCGCAACGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1036930639_1036930642 -7 Left 1036930639 8:12952123-12952145 CCCCTGGCTGCGGGACAGCGCTG 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1036930642 8:12952139-12952161 AGCGCTGTGACTACTCGCAACGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036930639 Original CRISPR CAGCGCTGTCCCGCAGCCAG GGG (reversed) Intronic
901189746 1:7402451-7402473 CAGCACTGTCCCCCAGCTTGGGG + Intronic
903265648 1:22156445-22156467 GAGCACTGTCCCCCAGTCAGTGG - Intergenic
905096792 1:35479035-35479057 GATTGCTGTCCCCCAGCCAGTGG - Exonic
906216702 1:44045274-44045296 CAGGGCAGTCCCGCAGCACGAGG - Intergenic
912860443 1:113209504-113209526 AAAGGCTGTCACGCAGCCAGAGG + Intergenic
915092889 1:153438920-153438942 CAGCCCTGTCCCGAACACAGGGG + Intronic
915250113 1:154581925-154581947 CAGGGCTGTCCCTCAGCCTTTGG - Intergenic
919809502 1:201399670-201399692 CCGCGCTGTGCCGCGGCCCGGGG + Intergenic
921181807 1:212637310-212637332 CGGAGCGGTCCCCCAGCCAGGGG - Intergenic
922775591 1:228213024-228213046 CACCGCTGGCCCACAGACAGGGG + Intronic
922821233 1:228487276-228487298 CAGCGGTGTGCTGCAGCCGGAGG - Exonic
1064532346 10:16323158-16323180 CAGCCCTGTCCCACAGCGTGAGG - Intergenic
1067575585 10:47406432-47406454 CAGGCCTGTCCCACAGGCAGGGG - Intergenic
1067711304 10:48653394-48653416 AAGCGCTGTCCCGCAGCCCAGGG - Intronic
1067776387 10:49167636-49167658 GAGCCCTGTCCCACAGCCATGGG - Intronic
1072092047 10:92138145-92138167 TACCACTGACCCGCAGCCAGAGG + Intronic
1074529252 10:114285973-114285995 CAGAGCTGTCCAGCAGGAAGAGG - Exonic
1075385659 10:122053566-122053588 CAGCACAGTCCCTCAGCCTGAGG - Intronic
1075723966 10:124602446-124602468 CAGAGCTCTCCACCAGCCAGTGG - Intronic
1076981569 11:207563-207585 CAGCACTGTCGCGCAGACAGTGG + Intronic
1078023588 11:7673955-7673977 CAGGGCTGACCCAGAGCCAGCGG - Exonic
1079818568 11:25094625-25094647 CTGCTCTGTCCCCCAGCCACAGG - Intergenic
1080213605 11:29816692-29816714 CAGCGATGTCCCCCAGCCCTTGG + Intergenic
1083901690 11:65646482-65646504 CAGAGCTGGCCCGAAGGCAGGGG - Exonic
1090409169 11:126495774-126495796 CAGTGCTGTGCAGCAGCCTGAGG + Intronic
1091225757 11:133955925-133955947 CAGCTCTGCCTCGCAGCCTGGGG + Intronic
1094000541 12:25689596-25689618 CAGCACTGTCCCAAAGCCTGGGG + Intergenic
1095048877 12:37540255-37540277 CAGCACTGTGCCACTGCCAGAGG - Intergenic
1096234014 12:49913614-49913636 CTTCTCTGTCCTGCAGCCAGGGG - Intergenic
1096263159 12:50105272-50105294 CCGCACTGTCCCACAGCCAAGGG + Intronic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1101529635 12:105562331-105562353 CAGCCCTGCACCCCAGCCAGTGG - Intergenic
1103725361 12:122995078-122995100 CAGGGCTGTCCTGAAGCCAGTGG - Intronic
1104747328 12:131218890-131218912 CAGCGATGACCCCCAGGCAGCGG + Intergenic
1109429385 13:62212361-62212383 CAGGGCAGTCCCACCGCCAGGGG + Intergenic
1113442732 13:110341752-110341774 CAGCTCTGTCTCGCTGCCAGAGG + Intronic
1118359600 14:65044781-65044803 CAGCTCTGCCCTGCACCCAGAGG - Intronic
1121283451 14:92715829-92715851 CAGGGATGTCCCACTGCCAGCGG - Intronic
1122666867 14:103335650-103335672 CAGAGCTGTTGCGCAGCCATTGG + Exonic
1122799357 14:104221978-104222000 CAGGGCTGCCCCTCAGCCTGGGG - Intergenic
1126668232 15:51093991-51094013 CATCGCTGCCGCGCAGCCGGCGG - Intronic
1126842491 15:52730798-52730820 CTGCTCTCTCCCCCAGCCAGAGG - Intergenic
1127960261 15:63885280-63885302 CAGGGCTGCCCCAGAGCCAGTGG + Intergenic
1128790022 15:70426304-70426326 CAGCGCTGAACCGAAGCCGGAGG - Intergenic
1129421708 15:75433007-75433029 TCGCGCTGTCCCCCAGCCTGGGG - Intronic
1129871369 15:78944022-78944044 CAGGGCTTTCCCCCAGCTAGAGG - Intronic
1130086243 15:80780139-80780161 TAGCGCTGTCCCGGAGGCACTGG - Intronic
1130327217 15:82890510-82890532 TAGCGCTGTGCCACAGCCAGGGG + Intronic
1130541052 15:84821132-84821154 CAGGGCTGTCACCCAGGCAGGGG - Intronic
1134600226 16:15528011-15528033 CATCTCTGTCCTGCAGCCAGAGG + Intronic
1136177141 16:28524963-28524985 CAGGGCTGTCCCACAGGCAGAGG - Intergenic
1137768760 16:50997715-50997737 CAGCCCTGCTCCGTAGCCAGCGG + Intergenic
1139936515 16:70575606-70575628 CAGCTCTGTTCTGCACCCAGAGG + Exonic
1139952062 16:70677365-70677387 CAGTCCTGTCCCACAGCCTGCGG - Intronic
1141661274 16:85442933-85442955 CCGTGGTGTCCCGCAGCTAGTGG + Intergenic
1142608560 17:1095758-1095780 CAGCTCTGTCCCCCAGCGACCGG + Intronic
1144447563 17:15344954-15344976 CAGCGCTGTCGTGGAGCCACTGG - Intergenic
1144632489 17:16881314-16881336 CAGGGCTGTCCCGAAGGCCGAGG - Intergenic
1144872525 17:18380018-18380040 CAGCACTGTCCCGTTGCCTGGGG + Intronic
1146686305 17:34843810-34843832 CAGGGCTGTTCGGCAGGCAGAGG + Intergenic
1147692999 17:42329500-42329522 TAGCCCTCTCCGGCAGCCAGAGG + Intronic
1148786079 17:50146874-50146896 CAGCCCTGTCCCAGAGCCTGGGG - Intronic
1154359206 18:13645161-13645183 CAGCGCCGTCCTTCATCCAGAGG + Exonic
1155218253 18:23662363-23662385 CAGCGCTGTCCTGCAGCAGAAGG - Intronic
1160243132 18:77137039-77137061 CAGCGCTGTGCTCCTGCCAGGGG - Intergenic
1160900064 19:1423459-1423481 CAGGCCAGTCCCGCAGTCAGAGG + Intronic
1160986054 19:1839448-1839470 GGGCGCTGCCCCTCAGCCAGGGG + Intronic
1161973467 19:7596346-7596368 CACCGCGCTCCCGCAGCCGGCGG - Intronic
1164836301 19:31357257-31357279 CCGCGCTGTCCCGCCTCCAGAGG - Intergenic
1165058532 19:33194168-33194190 CAGAGCTGTCCAGCACCCCGAGG + Intronic
1167373464 19:49098584-49098606 CAGAGCTGTCCCACAGCCCCTGG - Intronic
925684890 2:6459714-6459736 CAGGAGTGGCCCGCAGCCAGGGG - Intergenic
926018464 2:9474583-9474605 CAGGGCACTCCCGCAGCCCGCGG - Exonic
927688840 2:25192937-25192959 CACCGCTGTACCCCAGCCTGGGG + Intergenic
927928336 2:27028005-27028027 CAGCGCTGTCCTGCAGCTGGGGG - Intergenic
931790611 2:65660546-65660568 CATCTCTGTCACGCAGCCAAAGG - Intergenic
934653082 2:96103461-96103483 CCTAGCTGTCCCGCAGCCATCGG - Intergenic
934710968 2:96513734-96513756 CACCCCAGTCCCACAGCCAGTGG - Intergenic
934757056 2:96831804-96831826 CTGCGCTGCCCCACAGCCTGCGG - Intronic
934956378 2:98623878-98623900 CAGCGCTAGGCCCCAGCCAGTGG + Exonic
935124628 2:100212711-100212733 CAGCGATGACTTGCAGCCAGGGG + Intergenic
942247965 2:174024848-174024870 GAGCGCTGGCCCCAAGCCAGGGG + Intergenic
944412065 2:199455995-199456017 CGGGGCTGTCCCGCAGACACGGG + Exonic
945988228 2:216371656-216371678 CAGCGCTGCCATGCAACCAGAGG + Exonic
946441852 2:219703568-219703590 CATGGCTGTCGCACAGCCAGTGG + Intergenic
947625627 2:231616455-231616477 CAGGGCTGGGCCCCAGCCAGGGG - Intergenic
948529401 2:238594682-238594704 CAGGGCTATCCCACAGGCAGAGG - Intergenic
1169784490 20:9344415-9344437 CAGTGCCGTCCTGCAGACAGAGG - Intronic
1169911496 20:10651161-10651183 CAGCCCTGTCTCACAGCCAAAGG + Intronic
1170774526 20:19364099-19364121 CTGTGCTGTCCCACAGCCTGGGG + Intronic
1173645191 20:44628968-44628990 CAGGCCTGTCCCTCAGCCTGTGG - Intronic
1174057849 20:47810735-47810757 CTCCGCTGTCCTGCAGCCATGGG + Intergenic
1174402222 20:50282248-50282270 CTGGGGTGTCCCCCAGCCAGGGG + Intergenic
1175900031 20:62356349-62356371 AAGGGCGGTCCCGAAGCCAGGGG - Intronic
1175943592 20:62548860-62548882 CCACGCTCTCCCGCTGCCAGTGG + Intergenic
1178485861 21:33019962-33019984 CGGCGCTGGCCTGCAGCCCGGGG + Intergenic
1179959078 21:44758299-44758321 CAGCATGGTCCTGCAGCCAGAGG + Intergenic
1180132802 21:45837380-45837402 CAGCGCTGTGCTGCTGCCTGTGG - Intronic
1180995005 22:19961238-19961260 CAGACCCCTCCCGCAGCCAGAGG + Exonic
1181167337 22:20990897-20990919 AAGGGCTGGCCAGCAGCCAGGGG - Intronic
1181541575 22:23575818-23575840 CAGCCCTGTGTCGCATCCAGCGG - Intronic
1182270130 22:29148194-29148216 CAGAGCTGTCCGGCAGGCATTGG + Intronic
1183164227 22:36135456-36135478 CAGCGCTGCCCCGCCACCTGCGG + Intergenic
1183170548 22:36184614-36184636 CAGCGCTGCCCCGCCACCTGCGG + Intergenic
1183858379 22:40652047-40652069 CAGCCCTGCCAAGCAGCCAGCGG - Intergenic
1184640442 22:45867422-45867444 CAGGGGTGTCCCGCAGCCCCGGG + Intergenic
951535352 3:23735743-23735765 CAGCCCCTTCCCCCAGCCAGTGG + Intergenic
952418948 3:33114299-33114321 CCTCGCTGTCGCGCAGCAAGCGG - Exonic
954955861 3:54517852-54517874 CAGGGCTGTCTCATAGCCAGTGG + Intronic
955215193 3:56979497-56979519 CAGCCCTGTCCAGCTGCCACAGG + Intronic
961479583 3:127171341-127171363 CAGAGCTGTACCGCAGCCTGGGG - Intergenic
966620918 3:181963284-181963306 CAGCCCTGTCACACAGCCTGGGG - Intergenic
968114895 3:196081943-196081965 CGGTGCTGTCCAGCAGCCATAGG - Intronic
968509615 4:989697-989719 CAGCTGTGTCCGGCAGCCAGTGG + Exonic
974019028 4:56676755-56676777 CAGAGCAGCCCTGCAGCCAGAGG - Intronic
984713108 4:182902580-182902602 GAGCCCTGTCCCCCACCCAGGGG + Intronic
985150998 4:186946855-186946877 CAAGGCTCACCCGCAGCCAGAGG - Intergenic
988076580 5:26362531-26362553 CAACGATCTGCCGCAGCCAGTGG + Intergenic
995543115 5:113203361-113203383 CAGCGCTGTCCCTCCCCCACCGG + Intronic
997732887 5:136193551-136193573 CTGCGCTACCCAGCAGCCAGTGG - Intergenic
1002312887 5:178325311-178325333 GAGCGCTGTCCCAAAGACAGCGG - Intronic
1002780043 6:358728-358750 CAGCCCTGGCCCTCAGCCATGGG + Intergenic
1003603903 6:7542368-7542390 CAGCCGTGTCCAGCAGGCAGGGG - Intronic
1016859310 6:148700870-148700892 CTGTGTAGTCCCGCAGCCAGAGG + Intergenic
1017738169 6:157381779-157381801 CGGCGCTGGTCCGCAGCCCGCGG - Exonic
1018291494 6:162296277-162296299 CTGCGCTGCCTCCCAGCCAGGGG + Intronic
1019316407 7:388938-388960 CATCGCTGTCCTGAAGCCAAAGG - Intergenic
1019390544 7:784187-784209 CACGGGCGTCCCGCAGCCAGAGG - Intronic
1021452240 7:20793900-20793922 AAGTGCTGAACCGCAGCCAGAGG - Intergenic
1023582009 7:41693338-41693360 CAGTGCTGACCCGCATGCAGTGG + Intronic
1023828871 7:44028050-44028072 CATCACTGCCCCGCAGGCAGTGG + Intergenic
1026020442 7:66700976-66700998 CAGCGCTGTCTTGCAGCCCAAGG + Intronic
1029206438 7:98871776-98871798 CACAGCTGTCCCAGAGCCAGGGG - Intergenic
1029739171 7:102482307-102482329 CATCACTGCCCCGCAGGCAGTGG + Intergenic
1029757172 7:102581486-102581508 CATCACTGCCCCGCAGGCAGTGG + Exonic
1029775112 7:102680547-102680569 CATCACTGCCCCGCAGGCAGTGG + Intergenic
1035272549 7:157728968-157728990 CGGCGCTGACCCGGGGCCAGGGG + Intronic
1035453287 7:158992861-158992883 CAGCGCTGTCCCCCCGACAGAGG - Intergenic
1035453312 7:158992993-158993015 AAGCGCTGTCCCCCCGACAGAGG - Intergenic
1036930639 8:12952123-12952145 CAGCGCTGTCCCGCAGCCAGGGG - Intronic
1037676984 8:21059435-21059457 CAGCGGTGCCCCTCAGCTAGTGG - Intergenic
1049690467 8:143956724-143956746 CTGTGGTCTCCCGCAGCCAGAGG + Intronic
1049803832 8:144530146-144530168 CGGAGCTGACCCGCGGCCAGCGG + Exonic
1050363636 9:4854462-4854484 CAGCTCTGTCCCATATCCAGTGG + Intronic
1051352688 9:16213368-16213390 CAGGGCTGTCCCACAGACTGCGG + Intronic
1057479638 9:95434425-95434447 CAGCGCACTCCCGCAGCCGGAGG - Intergenic
1059414733 9:114155809-114155831 CAGCGCAGCCCCGCGCCCAGGGG - Exonic
1060992820 9:127858364-127858386 CAGCACTGGCCTGGAGCCAGGGG + Intergenic
1062624110 9:137435290-137435312 CACAGTAGTCCCGCAGCCAGCGG + Exonic
1062626961 9:137447770-137447792 CTGCTCTGTCCCCCAGCCACGGG + Exonic
1189269896 X:39743797-39743819 CAACTCTCTCCAGCAGCCAGTGG + Intergenic
1189321524 X:40090339-40090361 GAGGGCTGGCCTGCAGCCAGGGG - Intronic
1199919313 X:152381128-152381150 AAGCCCTGACCAGCAGCCAGTGG + Intronic