ID: 1036935940

View in Genome Browser
Species Human (GRCh38)
Location 8:13002939-13002961
Sequence GAGTGATCACCCTGAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036935940 Original CRISPR GAGTGATCACCCTGAGGAGC TGG (reversed) Intronic
900272973 1:1803396-1803418 GAGCCATCCTCCTGAGGAGCTGG + Intronic
900378636 1:2372966-2372988 GAGTCAGCACCCTGAGGTGCTGG + Intronic
900405098 1:2489523-2489545 GAGTGACCACCATGGGGAGATGG - Intronic
900468461 1:2837710-2837732 GAGAAATCACCCTGTGGACCAGG + Intergenic
900647616 1:3716060-3716082 AAGTGGGAACCCTGAGGAGCTGG - Intronic
900802900 1:4748281-4748303 GCGTGATCACCCTGCTGTGCTGG + Intronic
900832293 1:4973811-4973833 GGGTCAGCACCCTGTGGAGCAGG - Intergenic
901371327 1:8800566-8800588 AAGTGATCCTCCTGAGTAGCTGG - Intronic
901961256 1:12828345-12828367 CAGTGCTTTCCCTGAGGAGCTGG + Intronic
901967849 1:12882950-12882972 CAGTGCTTTCCCTGAGGAGCTGG + Intronic
901975653 1:12942080-12942102 CAGTGCTTTCCCTGAGGAGCTGG + Intronic
901983247 1:13053215-13053237 CAGTGCTTTCCCTGAGGAGCTGG + Intronic
901985762 1:13074117-13074139 CAGTGCTTTCCCTGAGGAGCTGG - Intronic
901996047 1:13152650-13152672 CAGTGCTTTCCCTGAGGAGCTGG + Intergenic
901998842 1:13175703-13175725 CAGTGCTTTCCCTGAGGAGCTGG - Intergenic
902009521 1:13259685-13259707 CAGTGCTTTCCCTGAGGAGCTGG - Intronic
902017327 1:13318830-13318852 CAGTGCTTTCCCTGAGGAGCTGG - Intronic
903615526 1:24652116-24652138 AAGTGATCCTCCTGAGTAGCTGG - Intronic
904106324 1:28088112-28088134 GAGTGAGCACAATGAGAAGCTGG + Intronic
904251899 1:29230981-29231003 GAGTGGTCACCCGGCGGGGCAGG - Intergenic
904378281 1:30095278-30095300 GGGTGACCACCATGAGGGGCTGG - Intergenic
906298530 1:44664035-44664057 GCCTCAGCACCCTGAGGAGCTGG - Intronic
906474865 1:46162367-46162389 AAGTGATCCTCCTGAGTAGCTGG - Intronic
907022831 1:51086046-51086068 CAGTGCTGCCCCTGAGGAGCAGG - Intergenic
907059614 1:51408535-51408557 AAGTGATCCTCCTGAGTAGCTGG + Intronic
908508827 1:64833942-64833964 TAGTGATCACCCAAAGGAACAGG + Exonic
909910221 1:81249395-81249417 GAGTGATCAGGGTGAGGATCAGG - Intergenic
910898769 1:92096650-92096672 AAGTGATCCTCCTGAGTAGCTGG + Intronic
912680046 1:111723313-111723335 CAGAGATCACCCTGAGGGGCGGG + Exonic
915463986 1:156085249-156085271 GGGTGGGCACCTTGAGGAGCTGG + Intronic
916016758 1:160756534-160756556 GACTTCTCACCCTGAAGAGCTGG - Intergenic
916244240 1:162671142-162671164 GAGGGCTGCCCCTGAGGAGCTGG + Intronic
916788578 1:168104790-168104812 GAGTAATCTCACTGAGGAGGAGG - Exonic
916966887 1:169956714-169956736 AAGTGATCCTCCTGAGTAGCTGG + Intronic
919478195 1:198054810-198054832 AAGTGATCCTCCTGAGTAGCTGG + Intergenic
920803033 1:209207346-209207368 GAGTGAGCAGCCTGAGAATCAGG + Intergenic
921509515 1:216011945-216011967 GCGTGATCAGGCTGAGGAACAGG - Intronic
922455257 1:225769100-225769122 GAGTGATAAGCCAGGGGAGCTGG + Intergenic
922906652 1:229178383-229178405 GCGTGATCACGGTGAGGAACAGG - Intergenic
1063575304 10:7256832-7256854 GATTGCTGACCCTGAGAAGCTGG + Intronic
1064795680 10:19008725-19008747 AAGTGCTCAGACTGAGGAGCAGG + Intergenic
1064888202 10:20136576-20136598 GAGAGATCACGATGAGGAGGTGG + Intronic
1065499133 10:26361926-26361948 CTGTGACCACCCTGAGGACCTGG + Intergenic
1065837990 10:29676649-29676671 GAGTTATCACCTTAAGGGGCCGG + Intronic
1066501290 10:35997212-35997234 GAGTGAGCACCTTGAGAAGCTGG - Intergenic
1066629108 10:37441167-37441189 GAGTGAGCACCTTGAGAAGCTGG - Intergenic
1068773960 10:60851781-60851803 GTGTGAGCACCCTGGGGAGGAGG + Intergenic
1070054651 10:72923524-72923546 GAGAGCTCAACCTGAGGAGGGGG - Intronic
1073770300 10:106728393-106728415 GAGCGAGCCCCCTGAGGAGGTGG + Intronic
1074440695 10:113475134-113475156 GAGTGGGGACGCTGAGGAGCTGG + Intergenic
1074471404 10:113730251-113730273 GTGGGATCATCCAGAGGAGCTGG + Exonic
1076618119 10:131770407-131770429 GAGAGATCACCGTGAGGTGCAGG + Intergenic
1077092672 11:786811-786833 GAGAGCTCAGCCTGAGAAGCAGG + Intergenic
1077169576 11:1160234-1160256 CAGTGATCCCACTGAGGGGCTGG - Intronic
1077599939 11:3567524-3567546 GACTGGTCACCATGAGGACCAGG - Intergenic
1077850539 11:6071599-6071621 GCGTGATCACGGTGAGGAACAGG + Intergenic
1078016190 11:7617204-7617226 TAGGGACCACCCTGAGGAGGTGG + Intronic
1081435517 11:43023371-43023393 GAGTGATCCTCCCGAGTAGCTGG - Intergenic
1083273427 11:61583529-61583551 GAGCCAGCACCCTGGGGAGCTGG + Intergenic
1083442966 11:62689086-62689108 AAGTGATCCTCCTGAGTAGCAGG - Intronic
1083588891 11:63880773-63880795 GAGTGATCACCAAGGTGAGCTGG - Intronic
1084564123 11:69920010-69920032 GAGGACTCACCCTGAGGAGGGGG - Intergenic
1085349855 11:75791395-75791417 GAACGCTGACCCTGAGGAGCAGG - Intronic
1085735127 11:79032251-79032273 CAGTAATCACCCTGAGGCGGGGG + Intronic
1086233848 11:84602685-84602707 GAGTGATCACCTTGGGGCTCTGG + Intronic
1088509625 11:110561178-110561200 GAGTGAGGTCCCTGAGGAGTGGG + Intergenic
1089590896 11:119540176-119540198 GTGTGAACCCCCTGAGGAGAAGG - Intergenic
1090871707 11:130755274-130755296 GCGTGATCAGCGTGAGGAACAGG + Intergenic
1091406673 12:213676-213698 CAGTGATTAGCCTGTGGAGCAGG - Intronic
1091447508 12:552491-552513 GATTGACCAGCCTGAGAAGCAGG + Exonic
1096718690 12:53505801-53505823 CAGTGAGCTCTCTGAGGAGCAGG + Exonic
1097688595 12:62713535-62713557 GACTGATGCCCCTGAGGATCAGG + Intronic
1097876297 12:64647348-64647370 AAGTGATCTTCCTGAGCAGCTGG + Intronic
1100661334 12:96702152-96702174 GAGTGTTCAACCTGAGCAACTGG + Intronic
1105433750 13:20360075-20360097 GAGTGCTCAGACTGAGGAGCAGG + Intergenic
1105702575 13:22944243-22944265 GAGTGAGCTTCCTGGGGAGCTGG - Intergenic
1105978038 13:25490555-25490577 GAGTGGTCTGCCTGAGGTGCAGG + Intronic
1108281764 13:48868663-48868685 GTGTGATCACGGTGAGGAACAGG + Intergenic
1108670636 13:52684638-52684660 GAGTAATCCTCCTGAGTAGCTGG + Intronic
1108947722 13:56044466-56044488 GCGTGATCAGGCTGAGGAACAGG - Intergenic
1110317857 13:74132195-74132217 GAGTGGTCACTTTGAGGAGTGGG - Intronic
1110765742 13:79278081-79278103 GCGTGATCAGCGTGAGGAACAGG - Intergenic
1118204792 14:63712767-63712789 AAGTGATCCTCCTGAGTAGCTGG + Intronic
1118209093 14:63750197-63750219 AAGTGATCCTCCTGAGTAGCTGG + Intergenic
1118927288 14:70204154-70204176 GATTGACCACCTTGAGGAACCGG + Intergenic
1119356007 14:74007148-74007170 AAGTGATCCTCCTGAGTAGCTGG - Intronic
1120592816 14:86395470-86395492 GAATGACCACCCTGGGGAGGGGG - Intergenic
1121304728 14:92898951-92898973 GAGCCACCACCCTGAGCAGCAGG + Intergenic
1121707742 14:96011690-96011712 GAGTGACAACCTAGAGGAGCTGG - Intergenic
1122875945 14:104664925-104664947 GCCTGATGCCCCTGAGGAGCTGG + Intergenic
1123161972 14:106287266-106287288 GAGTAATCATCCTGAGAATCAGG - Intergenic
1123635420 15:22303022-22303044 GGGGGATCTCCCTGGGGAGCAGG + Intergenic
1126806067 15:52350580-52350602 GAGTGATCACCTTGAAAACCTGG - Intronic
1130240566 15:82184480-82184502 GAGTCCTCTCCCTGAGGAGAAGG + Intronic
1132809261 16:1789813-1789835 GAGGGATCGCCCTGAGGACCAGG - Intronic
1133118597 16:3592532-3592554 CAGTGATGACCCTGTGGAACAGG - Intronic
1134487086 16:14667236-14667258 AAGTGATCCTCCTGAGTAGCTGG - Intronic
1135062584 16:19283517-19283539 AAGTGCTCAGACTGAGGAGCAGG - Intergenic
1135404010 16:22185208-22185230 GAGTGACCAGCCTGAGGGGATGG + Intronic
1135937326 16:26792506-26792528 GAGTGAGTCTCCTGAGGAGCGGG - Intergenic
1136598296 16:31266606-31266628 AAGTGATCCTCCTGAGTAGCTGG - Intronic
1137726497 16:50660142-50660164 AAGCGATCCCCCTGAGTAGCTGG - Intergenic
1139113967 16:63926460-63926482 GATTGACCACCCCGAGGAACTGG - Intergenic
1139230328 16:65277016-65277038 GCGTGATCAGGGTGAGGAGCAGG + Intergenic
1140207869 16:72948232-72948254 GAGTGACCAGCCTGAGGTTCAGG - Intronic
1140245437 16:73244226-73244248 GAGTATTCATCCTGAGGAGAGGG + Intergenic
1140263508 16:73400789-73400811 AAGGGATAACGCTGAGGAGCTGG + Intergenic
1141008440 16:80374920-80374942 GAGTGATCACCTACAGGAGCTGG + Intergenic
1141208178 16:81951087-81951109 AAGTGATCTTCCTGAGTAGCTGG + Intronic
1142115060 16:88352133-88352155 GAGTGACTACCCAGAGGAACAGG + Intergenic
1143032192 17:3974016-3974038 CAGTGAACACCCAGAGGACCAGG - Intergenic
1143642035 17:8204650-8204672 GCTGGCTCACCCTGAGGAGCCGG - Intergenic
1144933390 17:18878330-18878352 AAGTGATCCCCCTGAGTAGTTGG + Intronic
1146126991 17:30237925-30237947 GAGTGGGCACCCTGTGGACCTGG + Intergenic
1146350123 17:32085586-32085608 GTGGGAGGACCCTGAGGAGCAGG - Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146878139 17:36429073-36429095 GCCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147882038 17:43660449-43660471 CAGATATCACCCTGCGGAGCTGG - Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1153797072 18:8633676-8633698 GAGTGACAACCTTGAGGAGATGG + Intronic
1154357833 18:13635785-13635807 CAGGGACCACCCTGAGGGGCTGG - Intronic
1157586083 18:48802199-48802221 GAGGCCTCAGCCTGAGGAGCAGG - Intronic
1159909064 18:74126669-74126691 GACTGAAATCCCTGAGGAGCTGG + Intronic
1160586961 18:79918363-79918385 GGGTGTTCTCCGTGAGGAGCGGG + Intronic
1161073076 19:2271977-2271999 GAGTGCTCACCCAGGGGAGCAGG + Intronic
1161073093 19:2272028-2272050 GAGTGCTCACCCAGGGGAGCAGG + Intronic
1161276629 19:3421877-3421899 AAGTGATCCTCCTGAGTAGCTGG + Intronic
1162841130 19:13357248-13357270 TAGTGATGACCTTGAGCAGCAGG + Intronic
1162982158 19:14247416-14247438 GCGGGAGGACCCTGAGGAGCAGG + Intergenic
1164591276 19:29508732-29508754 AAGTGATGACTCTGAGGAGGAGG + Intergenic
1164776336 19:30856521-30856543 GAGTCATCACCTTCAGGGGCTGG + Intergenic
1165302471 19:34979491-34979513 GAGGGAGCACCCTGAAGAGCAGG + Intergenic
1167574013 19:50309150-50309172 AAGTGACCACACTGAGGAACCGG + Exonic
1168248515 19:55126970-55126992 GTGTGATCAGGCTGAGGAACAGG - Intergenic
926479721 2:13377350-13377372 GGGGGATCTCCCTGGGGAGCAGG + Intergenic
926728697 2:16018307-16018329 GCCTCAGCACCCTGAGGAGCTGG + Intergenic
927605042 2:24479492-24479514 AAGTGATCCTCCTGAGTAGCTGG + Intergenic
927713202 2:25338456-25338478 GAGGTGTGACCCTGAGGAGCTGG + Intronic
928111256 2:28510723-28510745 AAGTGATCCTCCTGAGTAGCTGG + Intronic
928517370 2:32056364-32056386 AAGTGATCCTCCTGAGTAGCTGG + Intergenic
931635600 2:64338389-64338411 AAGTGATTACCCTGAGGTACAGG + Intergenic
932147041 2:69330101-69330123 AAGTGATCCTCCTGAGTAGCTGG - Intronic
936067605 2:109344141-109344163 GAGTGTTCTCCCTGCGTAGCAGG - Intronic
937276532 2:120688070-120688092 AAGTGATGACCCAGAGGAGGAGG + Intergenic
939958424 2:148545945-148545967 GAGGGATGACCCTGAAGAACGGG + Intergenic
939958908 2:148549119-148549141 GAGTGCTCACACTGAGAGGCTGG - Intergenic
942311623 2:174661905-174661927 GAGTGCTTACCCTGAAGAACAGG + Intronic
943328896 2:186535463-186535485 GAGTGATCACACAGAGTGGCAGG + Intergenic
943421322 2:187672249-187672271 GAGTGATCAGGGTGAGGAACAGG + Intergenic
947382126 2:229554751-229554773 AAGTGATCCTCCTGAGTAGCTGG - Intronic
1169328194 20:4693985-4694007 AAGTGATCCTCCTGAGTAGCTGG - Intronic
1170251487 20:14288535-14288557 GTGTGATCACCCTGTGGGACAGG + Intronic
1171357784 20:24563522-24563544 GAGTGATAAGGATGAGGAGCTGG - Intronic
1173244617 20:41327561-41327583 AAGTGATCCTCCTGAGTAGCTGG + Intergenic
1173271371 20:41538880-41538902 GATTGACCACCTTGAGGAACTGG - Intronic
1177726045 21:24969717-24969739 TAGTGATCACAGTGAGGAGTGGG + Intergenic
1177748059 21:25245337-25245359 GAGAGGTCTCCCTGAGAAGCTGG - Intergenic
1180225351 21:46388801-46388823 CAGCCGTCACCCTGAGGAGCCGG + Exonic
1183220676 22:36510648-36510670 GAGAGTTCACTGTGAGGAGCTGG - Intergenic
1184969486 22:48005041-48005063 TAATGCTCACCCTGAGCAGCCGG + Intergenic
949653820 3:6193295-6193317 CAGTCATCATCCTGAGAAGCTGG + Intergenic
950947098 3:16960364-16960386 CAGTGATGACCCTGAGGGACTGG - Intronic
952889984 3:38033402-38033424 GAGTGATTCTCCTGAGTAGCTGG + Intergenic
953535042 3:43770849-43770871 GAGTCATCACACTGGGGATCAGG + Intergenic
954290793 3:49648963-49648985 GAGTAACCAGCCTGGGGAGCAGG + Intronic
956414926 3:69015437-69015459 AAGCGATCATCCTGAGTAGCTGG - Intergenic
957273449 3:78060854-78060876 AAGTGATCTTCCTGAGTAGCTGG + Intergenic
957633760 3:82754595-82754617 GATTCTTCACCATGAGGAGCTGG - Intergenic
963205267 3:142627730-142627752 AAGAGATCCTCCTGAGGAGCTGG + Intronic
964776704 3:160287130-160287152 TAGTGAACACACTGATGAGCTGG + Intronic
964983900 3:162716547-162716569 GTGTGATCACAGTGAGGAACAGG - Intergenic
966700389 3:182842683-182842705 GTGTGTTCAGCCTCAGGAGCAGG - Intronic
966743711 3:183255493-183255515 GACTGAGCACTCTGAGGAGGAGG + Intronic
968993636 4:3931322-3931344 GAGTGATCAGGTTGAGGAACAGG - Intergenic
970790201 4:19849152-19849174 GAGTTATCAACCAAAGGAGCTGG + Intergenic
975845689 4:78522971-78522993 AAGTGATCCTCCTGAGTAGCTGG - Intronic
977521216 4:98086818-98086840 AAGTGCTAAGCCTGAGGAGCAGG - Intronic
980210534 4:129781802-129781824 AAATGATCAACCTGAGGAGTGGG - Intergenic
980347699 4:131643831-131643853 GACTGAACACACTGAGGAACTGG - Intergenic
980575377 4:134679673-134679695 GCGTGATCAGGGTGAGGAGCAGG + Intergenic
981703018 4:147627661-147627683 AAGTGATCCTCCTGAGTAGCTGG - Intronic
982123647 4:152165562-152165584 GAGGGGTCAGCCTAAGGAGCTGG + Intergenic
983856752 4:172656266-172656288 GAGTGCTCAGACTTAGGAGCAGG - Intronic
984799180 4:183697207-183697229 AAGTGATCCTCCTGAGCAGCTGG - Intronic
985564658 5:609230-609252 GAGTGAGCACCGTGAGGAAGTGG + Intergenic
986169061 5:5301171-5301193 AAGTGATCTTCCTGAGTAGCTGG + Intronic
986260969 5:6146010-6146032 CAGTGAGCACCCTGGGGAGGTGG - Intergenic
988532175 5:32037381-32037403 GAGTTTTCAGCCTCAGGAGCAGG + Intronic
989027160 5:37081068-37081090 GAGTGATCCTCATGAGTAGCTGG - Intergenic
989057093 5:37376279-37376301 GATTGATCACATTGAGGAACTGG + Intergenic
990589946 5:57252196-57252218 AAGTGATCCTCCTGAGTAGCTGG + Intronic
991686904 5:69189757-69189779 AAGGGAACAACCTGAGGAGCAGG - Exonic
995122765 5:108553228-108553250 GAGTGATCAGGGTGAGGAACAGG - Intergenic
995516751 5:112962015-112962037 AAGTGATTCCCCTGAGTAGCTGG + Intergenic
995851986 5:116555723-116555745 AAGTGATCCTCCTGAGTAGCTGG - Intronic
998075517 5:139233002-139233024 GAGTGATCCTCCTGAGTAACTGG - Intronic
999305551 5:150517250-150517272 AAGTGATCCTCCTGAGTAGCTGG + Intronic
999369544 5:151045636-151045658 CAGTGGTCACTCTGAGGAGGTGG - Intronic
1001173115 5:169440377-169440399 GAGTAAACACCCTGAAGACCTGG + Intergenic
1001240894 5:170069160-170069182 CAGGGACCACCCTGAGGACCAGG + Exonic
1002694991 5:181081292-181081314 GACTGACCACCTTGAGGAACTGG - Intergenic
1002947439 6:1776575-1776597 GAGTGATCCTCCTGAGTAGCTGG - Intronic
1003124343 6:3343726-3343748 GACTGATGACCTTGGGGAGCTGG + Intronic
1003174918 6:3747195-3747217 GAGTTTTCAGCCTGAGGTGCAGG - Intronic
1003436257 6:6091168-6091190 GATTGACCATCCTGAGGAACTGG + Intergenic
1004169391 6:13284179-13284201 GTCTGGTCACCATGAGGAGCTGG + Intronic
1004335817 6:14763442-14763464 GAGTCATAGCCCTGAAGAGCTGG + Intergenic
1005609732 6:27512217-27512239 GTGGGATCTCCCTCAGGAGCAGG + Intergenic
1010090454 6:71974107-71974129 GATTGATCACCTTAAGGAACAGG + Intronic
1011760044 6:90554018-90554040 AAGTGATCCTCCTGAGTAGCTGG + Intronic
1016249153 6:142019970-142019992 GAGTGATCAGGGTGAGGAACAGG - Intergenic
1017960715 6:159218406-159218428 AAGAGATCACCGTGAGGAGGAGG + Intronic
1018175882 6:161178970-161178992 CGGTCATCACCCTGAGGAACTGG - Intronic
1018176147 6:161181027-161181049 CAGTCATCACCCTGAGGAACTGG + Intronic
1018963839 6:168468155-168468177 CAATGAGCACCATGAGGAGCTGG + Intronic
1019497888 7:1348943-1348965 GAGAGACCACCCTGGGGAACCGG - Intergenic
1019565904 7:1678953-1678975 GAGTGCTCACCCCGAGGAACTGG + Intergenic
1020667865 7:11069770-11069792 AAGTGATCCTCCTGAGTAGCTGG + Intronic
1021810905 7:24400222-24400244 GAGTGATCAGGGTGAGGAACAGG - Intergenic
1024023993 7:45396043-45396065 GATTGATCACCTTGAGAAACTGG - Intergenic
1024216880 7:47255596-47255618 GATTGATCACATTGAGGAACTGG - Intergenic
1024343652 7:48291609-48291631 GAGTGCTCGGACTGAGGAGCAGG - Intronic
1026897870 7:74020860-74020882 AAGTGATCCTCCTGAGTAGCTGG - Intergenic
1027427146 7:78072780-78072802 AAGTGATCCTCCTGAGTAGCTGG + Intronic
1028440519 7:90854426-90854448 AAGTGATCCTCCTGAGCAGCTGG - Intronic
1029476367 7:100787312-100787334 GAGTGATCCTCCTGAGTAGCTGG - Intronic
1031182668 7:118436741-118436763 GATAGATGAGCCTGAGGAGCTGG + Intergenic
1032345602 7:131113720-131113742 AAGTGATCCTCCTGAGGAGCTGG - Intronic
1035277990 7:157759336-157759358 GAGCGATGTTCCTGAGGAGCTGG + Intronic
1036023122 8:4871015-4871037 CTGTGCTCACCCTGGGGAGCTGG + Intronic
1036407172 8:8465325-8465347 AAGTGATCACCTTGAGGATGAGG - Intergenic
1036935940 8:13002939-13002961 GAGTGATCACCCTGAGGAGCTGG - Intronic
1036980580 8:13465936-13465958 GATTGATCACCTTGAGGAAATGG - Intronic
1038563283 8:28598680-28598702 AAGTGATCCTCCTGAGTAGCTGG + Intergenic
1038579283 8:28733498-28733520 AAGTGATCCTCCTGAGTAGCGGG + Intronic
1038822271 8:30963793-30963815 AAGTGATCCTCCTGAGTAGCTGG + Intergenic
1039406555 8:37318320-37318342 AAATGAACCCCCTGAGGAGCAGG + Intergenic
1039647580 8:39304305-39304327 GACTCAGCACCCTGAGTAGCTGG - Intergenic
1039888267 8:41667823-41667845 CAGTGAGGACCCTGAGGTGCTGG + Intronic
1041447287 8:57966412-57966434 AAGTGCTCAGGCTGAGGAGCAGG - Intergenic
1041705122 8:60838480-60838502 GAGCGATTAGCCTCAGGAGCTGG - Intronic
1041990319 8:63980600-63980622 GAGTGATCTCATTTAGGAGCAGG - Intergenic
1042092139 8:65170066-65170088 GAGTAATTACTATGAGGAGCTGG - Intergenic
1043919747 8:85967740-85967762 TAGTGATCCCTCTGAGGAGAGGG + Intergenic
1044973026 8:97638330-97638352 GACTGATCATCCTGGGGAGGAGG - Intergenic
1045414305 8:101951390-101951412 GAGTGAAGACAGTGAGGAGCTGG + Intronic
1046869879 8:119194168-119194190 GATTGATCACCCTGAGAACTGGG + Intronic
1048311001 8:133322551-133322573 GAGTCATCACCATGAGGGGCTGG - Intergenic
1048960723 8:139574580-139574602 GATTGACCACCCTGAGGAACTGG - Intergenic
1049186788 8:141259410-141259432 GAGGGATCACCCTTCGGAGCAGG + Intronic
1050102052 9:2129521-2129543 TAGTGAACACACTGATGAGCTGG - Intronic
1050748736 9:8910467-8910489 GAGTTATCACCATGTGGAACTGG + Intronic
1050788486 9:9435407-9435429 GAGGGATCCTCCTGAGTAGCTGG - Intronic
1051756671 9:20408359-20408381 GTGTGATCACACTGAGGAGGAGG - Intronic
1051878665 9:21817553-21817575 AAGTGAACAGCCTGTGGAGCAGG - Intronic
1056168501 9:83960470-83960492 AAGTGATCCTCCTGAGTAGCTGG + Intergenic
1057344360 9:94235285-94235307 GAGATATCACCTTGAGAAGCTGG + Intergenic
1057958655 9:99433685-99433707 GAGAGTTCACACTGAGGGGCTGG + Intergenic
1058812021 9:108649626-108649648 GAGGGGTCAACCTGAGGTGCCGG - Intergenic
1059094266 9:111395713-111395735 GAGGGCTCACACTGAGGAGTGGG - Intronic
1059574870 9:115477293-115477315 GCGTGATCAGGCTGAGGAACAGG - Intergenic
1062587874 9:137257908-137257930 AAGTGATCTTCCTGAGTAGCTGG + Intronic
1187890887 X:23933930-23933952 CAGTGATCCTCCTGAGTAGCTGG - Intronic
1193898725 X:87148371-87148393 GAGTGTTGAACCTGGGGAGCAGG - Intergenic