ID: 1036941843

View in Genome Browser
Species Human (GRCh38)
Location 8:13059241-13059263
Sequence CTTTAAGTGATCGGATAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036941840_1036941843 -3 Left 1036941840 8:13059221-13059243 CCTACATAGTTTACAGATCACTT No data
Right 1036941843 8:13059241-13059263 CTTTAAGTGATCGGATAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036941843 Original CRISPR CTTTAAGTGATCGGATAGGC AGG Intergenic