ID: 1036942430

View in Genome Browser
Species Human (GRCh38)
Location 8:13064494-13064516
Sequence TATTATCCAGAGAGGGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036942426_1036942430 -2 Left 1036942426 8:13064473-13064495 CCCATGAACAAGTCAGAGCTTTA No data
Right 1036942430 8:13064494-13064516 TATTATCCAGAGAGGGCTAGAGG No data
1036942425_1036942430 3 Left 1036942425 8:13064468-13064490 CCTATCCCATGAACAAGTCAGAG No data
Right 1036942430 8:13064494-13064516 TATTATCCAGAGAGGGCTAGAGG No data
1036942424_1036942430 4 Left 1036942424 8:13064467-13064489 CCCTATCCCATGAACAAGTCAGA No data
Right 1036942430 8:13064494-13064516 TATTATCCAGAGAGGGCTAGAGG No data
1036942423_1036942430 7 Left 1036942423 8:13064464-13064486 CCACCCTATCCCATGAACAAGTC No data
Right 1036942430 8:13064494-13064516 TATTATCCAGAGAGGGCTAGAGG No data
1036942427_1036942430 -3 Left 1036942427 8:13064474-13064496 CCATGAACAAGTCAGAGCTTTAT No data
Right 1036942430 8:13064494-13064516 TATTATCCAGAGAGGGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036942430 Original CRISPR TATTATCCAGAGAGGGCTAG AGG Intergenic
No off target data available for this crispr