ID: 1036942524

View in Genome Browser
Species Human (GRCh38)
Location 8:13065270-13065292
Sequence AAGGGGTTTGTCAAGTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036942515_1036942524 21 Left 1036942515 8:13065226-13065248 CCAGACAGTAGACTGTGAGCACG No data
Right 1036942524 8:13065270-13065292 AAGGGGTTTGTCAAGTCTGGAGG No data
1036942521_1036942524 -8 Left 1036942521 8:13065255-13065277 CCCAGGATTCATTTGAAGGGGTT No data
Right 1036942524 8:13065270-13065292 AAGGGGTTTGTCAAGTCTGGAGG No data
1036942522_1036942524 -9 Left 1036942522 8:13065256-13065278 CCAGGATTCATTTGAAGGGGTTT No data
Right 1036942524 8:13065270-13065292 AAGGGGTTTGTCAAGTCTGGAGG No data
1036942517_1036942524 -3 Left 1036942517 8:13065250-13065272 CCACGCCCAGGATTCATTTGAAG No data
Right 1036942524 8:13065270-13065292 AAGGGGTTTGTCAAGTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036942524 Original CRISPR AAGGGGTTTGTCAAGTCTGG AGG Intergenic
No off target data available for this crispr