ID: 1036942814

View in Genome Browser
Species Human (GRCh38)
Location 8:13067728-13067750
Sequence ACAAAGTAACACAAAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036942810_1036942814 -6 Left 1036942810 8:13067711-13067733 CCTAGACCCAAACCAAAACAAAG No data
Right 1036942814 8:13067728-13067750 ACAAAGTAACACAAAACAAAAGG No data
1036942808_1036942814 24 Left 1036942808 8:13067681-13067703 CCTTCAAAGACGCTATTGTCTAG No data
Right 1036942814 8:13067728-13067750 ACAAAGTAACACAAAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036942814 Original CRISPR ACAAAGTAACACAAAACAAA AGG Intergenic
No off target data available for this crispr