ID: 1036945694

View in Genome Browser
Species Human (GRCh38)
Location 8:13092528-13092550
Sequence GTCCCACAAAACCACAGCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036945693_1036945694 1 Left 1036945693 8:13092504-13092526 CCTTCTTGCTTGTTTCAGGAAAG 0: 1
1: 0
2: 1
3: 21
4: 283
Right 1036945694 8:13092528-13092550 GTCCCACAAAACCACAGCTACGG 0: 1
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036945694 Original CRISPR GTCCCACAAAACCACAGCTA CGG Intronic
906886424 1:49653294-49653316 ACCCCACAAAACCACATCCAAGG + Intronic
908499617 1:64730110-64730132 GTCCCACTTAACCACAACAATGG - Intergenic
909074992 1:71041988-71042010 GTCCCAGAAAACTAAACCTATGG + Intronic
909434232 1:75621764-75621786 GTCCCTAAAAACCTCAGCTGAGG - Intergenic
916282687 1:163069718-163069740 GTCACACAAAACAACACATAAGG - Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
916906871 1:169295616-169295638 GTTTCACAAAACCACAGCCATGG + Intronic
917640244 1:176976512-176976534 AACCCACAAAACCCCAGCCATGG - Intronic
919422191 1:197383722-197383744 GTTCCAGAAAACCAAAGCTCAGG - Intronic
920573030 1:207032469-207032491 GTCCCTCTATACCCCAGCTAGGG - Intronic
921299404 1:213736258-213736280 GTCCCACAAGACTGCAGGTAAGG + Intergenic
921501845 1:215914023-215914045 GTACCACAAAACCTCTACTAAGG + Intronic
1063688348 10:8259828-8259850 TGCCCACAAATCCACAGATACGG - Intergenic
1066038502 10:31520300-31520322 GTCCCACACGACCACAGATACGG + Exonic
1066416301 10:35224418-35224440 GCCCCACCAGACCACACCTAGGG + Intergenic
1067005262 10:42654959-42654981 GTCCCACAACACCACCTCTCAGG + Intergenic
1071045314 10:81367025-81367047 GTGCTACAAATCCCCAGCTAAGG - Intergenic
1072726183 10:97815561-97815583 TTCCCACCATACCACACCTAAGG - Intergenic
1074868878 10:117561651-117561673 GGCCCTGGAAACCACAGCTATGG + Intergenic
1077513871 11:2989137-2989159 GTCCCACAAAAATTCAGCTGAGG + Intronic
1079643504 11:22834984-22835006 GTATCCCAAAACCAGAGCTAAGG + Intergenic
1080578528 11:33622480-33622502 GCCCCACAGAACCAGAGTTAAGG + Intronic
1084493376 11:69490080-69490102 GTCCCTCAACACCCCAGCCAAGG + Intergenic
1089097295 11:115930016-115930038 CCCGCACAAAACCACATCTAAGG - Intergenic
1093023713 12:14226671-14226693 GTCCCTCAAAACAATAGCTAAGG + Intergenic
1093909233 12:24726932-24726954 TTCCCACACAACCACATCTTTGG + Intergenic
1099156446 12:79182302-79182324 GTCCCAAAAAATCACAGAAAGGG - Intronic
1099521437 12:83669079-83669101 GTCCCAGAAAAAGGCAGCTAAGG - Intergenic
1102131862 12:110537758-110537780 GTCCCACAAAGCCAGAGGAAGGG + Intronic
1102491748 12:113293478-113293500 GTCCCACACAACCCCAGCAGTGG - Intronic
1104022617 12:125003447-125003469 GTCCAACATAACCAAAGGTAGGG + Intronic
1107779637 13:43884668-43884690 TTCACACAAAATCACAGCTATGG - Intronic
1108784677 13:53881821-53881843 GTCACACAAAACCATATCTGTGG + Intergenic
1112660305 13:101500091-101500113 GTCTCACAAAATAACACCTAAGG + Intronic
1113331944 13:109335964-109335986 ATCCCACAATAACACAGTTATGG + Intergenic
1113424434 13:110196259-110196281 GTCCCCCACAGCCACTGCTAGGG + Intronic
1118485545 14:66211384-66211406 TTCCCCAACAACCACAGCTAAGG - Intergenic
1119015911 14:71054201-71054223 GTCCCACAAGTTCACAGATATGG - Intronic
1120195567 14:81478691-81478713 GTCCCACAAGACCAGTGCTCTGG + Intronic
1123774900 15:23569228-23569250 GTTCCACTAATTCACAGCTATGG - Intronic
1124046428 15:26155168-26155190 TCCCCACAAAACCTCATCTAAGG - Intergenic
1124070934 15:26392676-26392698 GTCCCTCAATACCATAGCAAAGG + Intergenic
1125399380 15:39283856-39283878 GTCCCAGAAAACAGCTGCTATGG + Intergenic
1126528018 15:49679501-49679523 GTCCCTCAAATCCACTGCAAAGG - Intergenic
1128502557 15:68237443-68237465 GTGCCACCAAACCCCAGCTTGGG + Intronic
1131077482 15:89504416-89504438 GTCCCTCAAAGCCACAGACAGGG + Intergenic
1131276887 15:90989799-90989821 GTCACAAAAGACCAGAGCTACGG + Intronic
1133131750 16:3680423-3680445 GTTCCCCAGAACCACAGCCAGGG - Intronic
1133839964 16:9399011-9399033 ATCCCAGAAAACAAAAGCTAGGG + Intergenic
1138231112 16:55337024-55337046 GTCCCAGAACACCACTTCTATGG + Intergenic
1140120476 16:72079164-72079186 GTCCCAGCTATCCACAGCTAAGG - Intronic
1142365427 16:89647441-89647463 GACCCACAAAACCCCAACTCTGG + Intronic
1143894951 17:10128400-10128422 GACCCACAAACCCACAGCCCGGG + Intronic
1145123294 17:20279784-20279806 GTCTTCCAAAACCACAGCTCTGG - Intronic
1156664685 18:39390745-39390767 GCCCCACAAAACCCCATCTAAGG + Intergenic
1158450334 18:57558295-57558317 TTCCAACAATACAACAGCTATGG + Intronic
1159868480 18:73733808-73733830 GTTCCACAAAGCCACAGATCTGG + Intergenic
1160804856 19:988174-988196 GTCCCACATAGCCAGAGCTCAGG + Intronic
1165056884 19:33183167-33183189 GTCCCACAGGCACACAGCTAAGG + Intronic
1165832141 19:38735584-38735606 GTCCCACACAGCCCCAGCTGGGG - Intronic
1167659053 19:50785323-50785345 GCCCCAAAAAACCACAGCCAGGG - Intergenic
1168468734 19:56624317-56624339 ATCACAGAGAACCACAGCTATGG - Exonic
925329428 2:3046993-3047015 GCCCCACTAAAGCACTGCTATGG - Intergenic
928451918 2:31385345-31385367 GTGTCACAAAACCACAGTTGGGG + Intronic
928456753 2:31429255-31429277 TCCCCACACAACCACACCTAGGG + Intergenic
930041284 2:47126723-47126745 TTCCCAGACAACCAAAGCTAAGG - Intronic
931970406 2:67579440-67579462 GTCCCCCAAACCCACAGTTAGGG - Intergenic
932936625 2:76110575-76110597 GTCCCACAAGACTACAGTCAAGG + Intergenic
935589433 2:104832386-104832408 GTCCCAAAGAACAACTGCTAAGG + Intergenic
936440067 2:112543573-112543595 ACCCAACAAAACCACAGGTAGGG - Intronic
936610135 2:113994260-113994282 GTCACAAAAGACCACTGCTATGG - Intergenic
937287059 2:120760354-120760376 TTCCCTCAAAAGCACAGCGATGG - Intronic
941157089 2:161992574-161992596 GTGCTACAAAAACACAGCAAGGG - Exonic
942496316 2:176543331-176543353 CTCCCAGGAAACCAAAGCTATGG + Intergenic
943190121 2:184665601-184665623 GTCTCACAAAACCAGAGGCAAGG + Intronic
943762124 2:191621622-191621644 GCCCCACAAAACCTGAGGTAGGG - Intergenic
944217012 2:197266439-197266461 GACCCAGAAAACCACAGATGAGG + Intronic
944405879 2:199382949-199382971 GCCTCACAAAATGACAGCTATGG + Intronic
944497102 2:200317920-200317942 TTCCCAAACACCCACAGCTAAGG - Intronic
948429439 2:237909761-237909783 GGCCTACAAACCCACATCTATGG + Intronic
1168747148 20:253366-253388 GTTGCCCAAAACCAGAGCTAAGG - Intergenic
1172594487 20:36141002-36141024 ATCCCACAAAACCCCATCTGGGG - Intronic
1180127813 21:45804028-45804050 GGCCCACAACACCACAGATGAGG - Intronic
950235282 3:11314435-11314457 GTTCCACAAAACCACAACCTCGG - Intronic
954266176 3:49471929-49471951 GGCCCTGAAAACCACAGCTCAGG - Intronic
960963878 3:123091155-123091177 CTCCCAGGAAACCACAGCCAGGG - Intronic
961103777 3:124223728-124223750 GACCCACAAAACCACAGACAGGG + Intronic
961329674 3:126131165-126131187 GTCTCACAAGGCCAAAGCTAAGG - Intronic
961550734 3:127669351-127669373 TTCCCACAAAACCATGTCTAAGG - Intronic
967990576 3:195127290-195127312 GTAACACAAAACCAAATCTACGG - Intronic
968269894 3:197395392-197395414 GACACAAAGAACCACAGCTAAGG + Intergenic
974594904 4:64001982-64002004 GTTGCCCAAAACCAGAGCTAAGG - Intergenic
974627726 4:64445404-64445426 GTTCCCCAAAACCTGAGCTATGG - Intergenic
981009343 4:139909535-139909557 ATCCCACAAACCCAAAGATAAGG + Intronic
986783579 5:11089689-11089711 CTTCCACAAAACGACTGCTAGGG + Intronic
990170922 5:53048754-53048776 GCCCCACAAAGACACAGGTATGG + Exonic
990608653 5:57436031-57436053 CTCCCACAGACCTACAGCTATGG - Intergenic
993717841 5:91293363-91293385 GTCACACAGAACCACAGCATGGG + Intergenic
993921799 5:93814433-93814455 CTCCCAGAAACCCAGAGCTATGG - Intronic
1001759799 5:174197913-174197935 GTCTCACACATCCACAGCCAAGG + Intronic
1002010220 5:176273345-176273367 CTCCAACAAACCTACAGCTAAGG + Intronic
1012245521 6:96922180-96922202 GTCCCACACTACCACAACTGAGG + Intergenic
1013226722 6:108124289-108124311 GCCCCACACAACAAAAGCTAGGG + Intronic
1014523437 6:122472770-122472792 GGTCTACAAAACCACAGATAAGG - Intronic
1015571263 6:134623718-134623740 GTCCTGCAAAGCCAAAGCTATGG - Intergenic
1015840530 6:137471957-137471979 GGCCCACAGAACCAGAGCTGAGG + Intergenic
1017653193 6:156601681-156601703 GGACATCAAAACCACAGCTACGG - Intergenic
1018812782 6:167309397-167309419 TTCCCAAAAAACCCCATCTAAGG + Intronic
1019300092 7:298484-298506 GTCGAACAGAACCACAGCTAGGG - Intergenic
1019385280 7:752033-752055 GACTCACAAAACCACAGTCATGG + Intronic
1026297082 7:69062593-69062615 ATCCAGCAAAACCACAGCCAAGG + Intergenic
1026489156 7:70847936-70847958 GTCCCAACAAACTAAAGCTAAGG + Intergenic
1026599639 7:71766862-71766884 GTCCCCCAAAACCACAGACATGG + Intergenic
1028172659 7:87617323-87617345 GTCCCAGAAAACCAAAACTTTGG + Intronic
1028314072 7:89377827-89377849 TTACCACAAAACAAAAGCTAAGG - Intergenic
1035402489 7:158576603-158576625 GTCCCACAGAAGCACAGCATGGG + Intronic
1035788428 8:2281189-2281211 GTCCCACAGATTCACAGCCATGG - Intergenic
1035804377 8:2440516-2440538 GTCCCACAGATTCACAGCCATGG + Intergenic
1036945694 8:13092528-13092550 GTCCCACAAAACCACAGCTACGG + Intronic
1045673790 8:104587446-104587468 GTCCCACACAAGCACACCTCTGG + Intronic
1052536323 9:29752179-29752201 GTCCAACAAAAGCACAGCGTTGG - Intergenic
1057825481 9:98369454-98369476 AGCCCACAGAATCACAGCTAAGG + Intronic
1058660424 9:107261695-107261717 GTCCCAAAACACAACAGCTTTGG - Intergenic
1185541375 X:905518-905540 GCCCCAAAAAACCACAGATTGGG + Intergenic
1186528392 X:10270571-10270593 GTCTCACAAGACCAAAGCCAAGG - Intergenic
1191930189 X:66364281-66364303 GTGCCACACAACCACTGCTGGGG - Intergenic
1194922088 X:99779180-99779202 GTACCACACCACCACTGCTAGGG + Intergenic
1195781161 X:108466261-108466283 GGCCCATAATACCACACCTAAGG - Intronic
1197930921 X:131695525-131695547 GTCACCCAAACCCAGAGCTAAGG - Intergenic
1200564150 Y:4743196-4743218 CTACCACAAAAACACACCTAAGG + Intergenic