ID: 1036949681

View in Genome Browser
Species Human (GRCh38)
Location 8:13129220-13129242
Sequence TGAAGGCTGTTCCTCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036949681_1036949686 7 Left 1036949681 8:13129220-13129242 CCTTCAAAGAGGAACAGCCTTCA 0: 1
1: 0
2: 0
3: 19
4: 162
Right 1036949686 8:13129250-13129272 CTGCATTCATCCATATGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036949681 Original CRISPR TGAAGGCTGTTCCTCTTTGA AGG (reversed) Intronic
905536612 1:38727229-38727251 TCAAATCTGTTCCTCCTTGAGGG + Intergenic
906150570 1:43585176-43585198 TGAGGCCTGTTCCTTTTTGGAGG + Intronic
906805134 1:48773421-48773443 CTAAGGCTGTCCCTCTTGGAGGG - Intronic
909267898 1:73585501-73585523 GGAAGATTGTTTCTCTTTGAAGG - Intergenic
912210014 1:107546991-107547013 TGGAGGCTGTTCCTAGCTGATGG - Intergenic
915781366 1:158554507-158554529 TGAAGGCTGTGCCTCTTGGGAGG - Intergenic
916193270 1:162199224-162199246 TGGAGGTTTTTACTCTTTGATGG + Intronic
918192179 1:182186455-182186477 TGAAGGCTGTTTGGCTTTGCTGG - Intergenic
919094324 1:193011538-193011560 TGTAGGGTGTTCCCCATTGATGG - Intergenic
922029261 1:221782167-221782189 TGAAGGCCATTCCACTTTGCAGG + Intergenic
924770509 1:247075856-247075878 TCAAGTCTGTTCTTTTTTGAAGG - Intronic
924851250 1:247833484-247833506 TGCAGGCTGCTCTTCTGTGAGGG + Intergenic
1065160169 10:22911481-22911503 AGAAGGCTCTTCATGTTTGAAGG - Intergenic
1065302773 10:24338545-24338567 TGACAGCTGTCTCTCTTTGAAGG - Intronic
1066036712 10:31496439-31496461 TTAAGGCTATTCCTCTGTAATGG + Intronic
1066501087 10:35995524-35995546 TGAATGATGTTCCCCTTTCACGG - Intergenic
1067537199 10:47121751-47121773 TGGAGCCAGTTCCTCTGTGATGG + Intergenic
1068422572 10:56815087-56815109 TGAAGGCTTTTTCTCTTTAATGG - Intergenic
1068426279 10:56868572-56868594 TGAAGTCTGCTCCTTTTTGCAGG - Intergenic
1069225932 10:65944228-65944250 TGTAGTTTGTTTCTCTTTGAGGG - Intronic
1069839922 10:71333425-71333447 GGAAGGCTGTTTCTCTTTGGAGG - Intronic
1075516176 10:123110084-123110106 TTATGGCTGTTTTTCTTTGATGG + Intergenic
1076586992 10:131556098-131556120 TGTGTGCTGTGCCTCTTTGAGGG - Intergenic
1078491037 11:11769051-11769073 TGAAGGCTGTGAATTTTTGATGG - Intergenic
1078860301 11:15240479-15240501 TCACTGCTGTTCCTCTCTGATGG - Exonic
1079229329 11:18635691-18635713 TGCTGGCTCTTACTCTTTGATGG + Intergenic
1079889616 11:26034557-26034579 TGTAAGGTGTTCCTCTTTTAAGG + Intergenic
1080047365 11:27822830-27822852 TGAAGCCTGATCCTCTTGGATGG + Intergenic
1080822076 11:35817029-35817051 TGATGTCTGTAACTCTTTGAAGG + Exonic
1082959189 11:58902658-58902680 TGAGGGCTTTTCTTCTTTGTGGG + Intronic
1083627973 11:64081707-64081729 TGAAGCCTGTTCCTGCTTGGGGG + Intronic
1084701986 11:70792647-70792669 TGGAAGCTGTTTCTCTTTTATGG - Intronic
1084760899 11:71270266-71270288 TGGAGGCAGTTCCTCTATGGAGG + Intergenic
1086214479 11:84362267-84362289 TGAAGGCATTTACTCTTTCAAGG - Intronic
1086914120 11:92508369-92508391 TGAAGGCTGTTACTTTATAAGGG + Intronic
1090510782 11:127372553-127372575 TGACGTCTGTTCCTGTTTCATGG + Intergenic
1096266323 12:50125548-50125570 CTAAGGCTGTTGCTCTTTCAGGG + Intergenic
1097637733 12:62143221-62143243 AGAAGGCTGTTAGTCTTGGAAGG - Intronic
1098635450 12:72779054-72779076 TATAGGCTTTTCCTCTTTCATGG + Intergenic
1103077493 12:117996304-117996326 TTAAGGGTGTAACTCTTTGAGGG + Intergenic
1109283431 13:60383704-60383726 TAATGCCTTTTCCTCTTTGATGG - Intergenic
1110448149 13:75611300-75611322 TGAAGGCTTTTAGTTTTTGAAGG + Intergenic
1110451407 13:75641072-75641094 TGGAGGCTGCCTCTCTTTGAAGG - Intronic
1112791053 13:103002525-103002547 TGAAGACTGCTTCTCATTGAAGG + Intergenic
1112930310 13:104727411-104727433 TGAAAGCTTTTCCTCTAAGATGG + Intergenic
1113314765 13:109166988-109167010 TGAAGGCTGATCCATTTTCAAGG + Intronic
1114956325 14:27824309-27824331 TGAAGTCTGTTTGCCTTTGAAGG + Intergenic
1116047990 14:39767521-39767543 TGAAAATTGTCCCTCTTTGAAGG - Intergenic
1116800495 14:49438772-49438794 TTATGGCTGTTCCACTTTTAAGG + Intergenic
1117571496 14:57053557-57053579 TGGGGGCTGCTCCTCTTAGACGG + Intergenic
1118400203 14:65372733-65372755 AGAATGCTGTTCCTGTTTCATGG + Intergenic
1120409089 14:84128982-84129004 TGAATGCTATGGCTCTTTGAGGG - Intergenic
1121363422 14:93284169-93284191 TTAATGCTGTTCATCTTTTAAGG - Intronic
1121379989 14:93456623-93456645 TTAGGGATGTTCCTCTATGAAGG + Intronic
1122337000 14:100998351-100998373 TAAAGGCTGTTACTCATTTATGG + Intergenic
1124393619 15:29281791-29281813 TGAAGTCTGTTCCTCTTGTTGGG - Intronic
1125579142 15:40773548-40773570 TGAACCCTTTTCCTCTCTGAGGG - Intronic
1137877897 16:52014732-52014754 TGAAGGCAGCTGCTCTTTGGTGG - Intronic
1139083006 16:63548475-63548497 GGCAAACTGTTCCTCTTTGATGG + Intergenic
1140341219 16:74165079-74165101 TTAGGGTTGTTCCTCTTTGAAGG + Intergenic
1142029054 16:87829432-87829454 TGAAGGCTGCTCCTATCTGCAGG - Intergenic
1203145543 16_KI270728v1_random:1795659-1795681 TGCAGGCTGGGCCTCTCTGAGGG - Intergenic
1144704290 17:17357032-17357054 TCAAGCCTGTTCTTCCTTGAAGG + Intergenic
1145313556 17:21714590-21714612 TGAAGCATGTTTCTCTTTAAAGG + Intergenic
1148858731 17:50593127-50593149 TGATGGCTGTGCCTCTTGCAGGG + Intronic
1150657129 17:67046621-67046643 TGGAGGCTGTTCCTGTTTATGGG - Intronic
1151053781 17:71008784-71008806 TCATGGCTGTTTTTCTTTGATGG - Intergenic
1153880259 18:9416184-9416206 AGAAGTCTCTTCCTCTTTGAAGG - Intergenic
1154983468 18:21524408-21524430 ATAAGGCAGGTCCTCTTTGAAGG - Exonic
1156697861 18:39789262-39789284 TGAAGCCTGTTTTCCTTTGAGGG - Intergenic
1156816701 18:41320170-41320192 TGAAGGCTGTTACTCCTGGAAGG - Intergenic
1157117822 18:44878848-44878870 TGCAAGCTGTTCCACTATGAGGG - Intronic
1157283957 18:46364546-46364568 TGAAGGCTTTTCCAGTTAGAGGG - Intronic
1157571137 18:48713158-48713180 TGAACCCTATTCCTCCTTGAGGG - Intronic
1158119562 18:54033510-54033532 TGAAGGCTGTTTACATTTGAGGG - Intergenic
1158156420 18:54430619-54430641 TGAAGGCTGCTCCACGGTGAAGG + Intergenic
1159296750 18:66500266-66500288 TGAAGGCTGGTCCTCTGTCATGG + Intergenic
1161561749 19:4977193-4977215 GGCAGGCTGTGCCTCTTTGGCGG + Intronic
927149442 2:20187305-20187327 GGAAGGCTGTTCCACTTTCAAGG + Intergenic
927875331 2:26651417-26651439 TTAGGGCTCTTCCTCTTTGGTGG - Intergenic
928079905 2:28301645-28301667 TGAAGGATGTGTCTGTTTGAGGG - Intronic
928215730 2:29359972-29359994 TGAAAGCTGTTCCTCTCTCCAGG + Intronic
928873302 2:36006968-36006990 TAAAACCTGTTCATCTTTGAGGG + Intergenic
928986586 2:37188343-37188365 TGAAGGCGGTTCCTCATTGCAGG - Intronic
934480953 2:94643676-94643698 TGAAGTCTGTTTGCCTTTGAAGG - Intergenic
935370696 2:102343572-102343594 TGTAGACTGTTCCTGTTTGCTGG + Intronic
935802694 2:106714565-106714587 TGAAGACTGTTCATCCTTGCTGG - Intergenic
936630094 2:114192682-114192704 TGAAGGCTGATTTTCTTTGGGGG + Intergenic
936686472 2:114832615-114832637 TGAAGGCTCTTACTATTTTATGG - Intronic
937622127 2:124000904-124000926 TGTAGGCTGTTACTTTTTGAGGG + Intergenic
938926292 2:136045904-136045926 TGAAAGCTTTTCTTCTTTGAAGG - Intergenic
939527124 2:143309543-143309565 TGAATACTATTCCTCTGTGATGG + Intronic
941083724 2:161092168-161092190 TGAGGGCTGTTCCTCAAAGATGG + Intergenic
941990592 2:171552659-171552681 TGAAGTCTGTTGCGCTTTCACGG - Intronic
945846821 2:214955297-214955319 TGAAGGCCATTCCTGTTTCATGG + Exonic
948337471 2:237221673-237221695 TGAAGGCTGTTCCACTTCCCAGG + Intergenic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1169918295 20:10705867-10705889 GGAAGGCTGCTGCTTTTTGAAGG - Intergenic
1170211577 20:13850710-13850732 TCAAGGCTGTTCTTTATTGAGGG - Intronic
1172067723 20:32233516-32233538 TAAAGGGTGTTCCACTTGGAGGG + Intronic
1172212474 20:33210578-33210600 TGTAGGCTGTTCCTGCCTGAGGG - Intergenic
1173659672 20:44724683-44724705 AGAAGGCTGTGCCGCTTTGCGGG + Intronic
1182149049 22:28015902-28015924 AGAAGGCTGCTCCTCTCTGCTGG + Intronic
1182571698 22:31244023-31244045 AGAAGGCTGTTCCTCTTCCAGGG + Intronic
1185248465 22:49786311-49786333 TGACAGCTGCTCCTCTTTAAAGG + Intronic
951215767 3:20023732-20023754 TACAGGCTGTTACTGTTTGAGGG + Intergenic
952834588 3:37592301-37592323 ATAAGGCTATTCCTCGTTGAAGG + Intronic
953924039 3:46971886-46971908 TGAAGCCGCTTCCTCTCTGAAGG + Intronic
954702723 3:52459349-52459371 TGAAAGTTGTTCCTCTTTCAAGG - Intronic
959387228 3:105725796-105725818 TGAAGACTGGTCGCCTTTGAAGG + Intronic
960055962 3:113276518-113276540 TGAAAGCAGTTCCTCTCTTACGG + Intronic
967418816 3:189251354-189251376 TGAAGGCAGATTCTCTTTGAAGG + Intronic
969504025 4:7572586-7572608 AGAATGCTTTTCATCTTTGAAGG - Intronic
972890868 4:43554458-43554480 TAAAGGATTTTCCTCTTTGCTGG + Intergenic
975970479 4:80028626-80028648 TGAAGGTTTTTCCTGTGTGAGGG - Intronic
977780487 4:100975911-100975933 TGAAGGCTATTCTTTTTTTATGG + Intergenic
979519248 4:121647593-121647615 TGAATGCTTTTTCTTTTTGAAGG - Intergenic
984117936 4:175705604-175705626 CCAAGGCTGTTCCTCTCTGTGGG - Intronic
990118076 5:52413940-52413962 TGTAAGCTGTTCCATTTTGAAGG - Intergenic
990657828 5:57977201-57977223 TGAAAGCTGTAGCTCTCTGAAGG + Intergenic
990788521 5:59450700-59450722 TGGAGAATGTTCCTTTTTGATGG - Intronic
995059799 5:107801561-107801583 TGAAGACTGCTCCTCTCTAAAGG - Intergenic
995121252 5:108537692-108537714 TGAAGAATGTTCATTTTTGATGG + Intergenic
998353733 5:141517511-141517533 TGGCTGCTGTTCCTCTTTGCGGG - Intronic
998684099 5:144504727-144504749 TGAAGGCTGTGCAGCCTTGAGGG + Intergenic
999778660 5:154831128-154831150 TGAAGGTTGTCCCTATTTTATGG - Intronic
1000293080 5:159889428-159889450 TGAAGCCTCTTCCTATTTGGAGG + Intergenic
1001215848 5:169855045-169855067 TGAAGGCTGGAGTTCTTTGAGGG - Intronic
1004211339 6:13648823-13648845 TGAAGGCTGTTGCTTTTTAAAGG - Intronic
1004470864 6:15928052-15928074 TGAAAGTTGTTTCTCTTAGAAGG + Intergenic
1005530301 6:26697866-26697888 TGATGGCTATTCCTCTGCGAGGG - Intergenic
1005540495 6:26803780-26803802 TGATGGCTATTCCTCTGCGAGGG + Intergenic
1008668244 6:53738818-53738840 TGAAGGCTCTGCCTCTTGAATGG - Intergenic
1009011310 6:57845877-57845899 TGATGGCTATTCCTCTGCGAGGG + Intergenic
1013270168 6:108537764-108537786 TGATGGGTGTCCCTCTTTGATGG + Intergenic
1013583916 6:111561792-111561814 TTTTGGATGTTCCTCTTTGATGG + Intronic
1015297548 6:131615014-131615036 TGAAGCCTGTCACTTTTTGATGG - Intronic
1015987501 6:138899228-138899250 TGATGGGTGTTCTCCTTTGATGG - Intronic
1017993742 6:159512317-159512339 TCAAGGATGTTTCTCTTTGTAGG - Intergenic
1020711455 7:11610900-11610922 TGAAAGCTATTTCTCTTTAATGG + Intronic
1025564628 7:62418284-62418306 AAAAGGCAGTTCATCTTTGAAGG + Intergenic
1026731243 7:72913566-72913588 TGGAGGCTGCTCCTCTTCTAAGG + Intronic
1027112842 7:75454503-75454525 TGGAGGCTGCTCCTCTTCTAAGG - Intronic
1027285086 7:76639114-76639136 TGGAGGCTGCTCCTCTTCTAAGG - Intergenic
1027866730 7:83658023-83658045 TGAAGGCTCTGCCTTTATGATGG + Intergenic
1030490542 7:110227873-110227895 TGATGCATGTTCCTCTGTGAAGG - Intergenic
1031220745 7:118962147-118962169 AGAAGTCTTTTCCTCTTTGAAGG - Intergenic
1031963295 7:128008782-128008804 TGATGTCTGTTCGTCTTTTAAGG + Intronic
1032992696 7:137411427-137411449 TCAAGACTGTTCCTATTTCATGG - Intronic
1034033210 7:147790374-147790396 TGAACTCTGTTCCTCTATGCAGG - Intronic
1035045311 7:155961832-155961854 TGAGGGCTGTGCCTCTTCGGTGG + Intergenic
1035517274 8:246110-246132 TGAAGGCTTTTCCGCATAGATGG - Exonic
1036949681 8:13129220-13129242 TGAAGGCTGTTCCTCTTTGAAGG - Intronic
1037313495 8:17579687-17579709 GGAAGTCTTTTCCTCTTAGAAGG - Intronic
1038307642 8:26419304-26419326 TGAAGGCTGGTTCACTTGGAGGG - Intronic
1043338407 8:79206637-79206659 TGAAGTCTGTGCCCCTTTCAAGG + Intergenic
1044355522 8:91217985-91218007 AGAAGGCTGTTACTCTCTCAAGG + Intronic
1044740969 8:95326177-95326199 TGATGACTGTTTCTCTTTGAGGG + Intergenic
1045548467 8:103149387-103149409 TAAAGACTGTTCCTGTTTAATGG - Intronic
1045766791 8:105681903-105681925 TGAAGGCTGTTACCCTGTGCAGG + Intronic
1046406157 8:113775355-113775377 TGGAGATTGTACCTCTTTGAGGG + Intergenic
1047399197 8:124531885-124531907 TGAAGGTTGTTTGTCTTTGCAGG + Intronic
1048483357 8:134823167-134823189 TGTAGGCTGTTCCCGTTGGATGG - Intergenic
1049852795 8:144842688-144842710 TGAAGGCTTTTCCGCATTGGAGG - Exonic
1053676883 9:40440293-40440315 TGAAGTCTGTTTGCCTTTGAAGG + Intergenic
1053926649 9:43066390-43066412 TGAAGTCTGTTTGCCTTTGAAGG + Intergenic
1054286833 9:63184614-63184636 TGAAGTCTGTTTGCCTTTGAAGG - Intergenic
1054289953 9:63275816-63275838 TGAAGTCTGTTTGCCTTTGAAGG + Intergenic
1054387984 9:64580360-64580382 TGAAGTCTGTTTGCCTTTGAAGG + Intergenic
1054507738 9:65936009-65936031 TGAAGTCTGTTTGCCTTTGAAGG - Intergenic
1054990038 9:71314731-71314753 TGAAGGCTTTTCTAATTTGAGGG + Intronic
1058054003 9:100431698-100431720 TGAAGGCTCTCCCTATCTGACGG - Intronic
1058900310 9:109436659-109436681 TGAAGACTTTTCCCTTTTGAAGG - Intronic
1060700242 9:125745108-125745130 TGAAGGGGGTTCTTCTTTGGAGG + Intergenic
1060915973 9:127390890-127390912 AGCAGCCTGTTCCTCTCTGAGGG + Intronic
1061207265 9:129172007-129172029 AGAAGGCAGTTCCTCTTGGGTGG + Intergenic
1061596159 9:131630553-131630575 TAAAGGCACTTCCTCTTGGAAGG + Intronic
1190415207 X:50174093-50174115 TGAAGCCTGAGGCTCTTTGAAGG + Intergenic
1194361672 X:92959728-92959750 TAGAGGCTCTTTCTCTTTGAAGG - Intergenic
1195199715 X:102536008-102536030 TGAAGGGTGTTTTTCTCTGATGG - Intergenic
1196925189 X:120627136-120627158 TGAAAGCAGCTCCTTTTTGAAGG - Exonic
1200669863 Y:6075605-6075627 TACAGGCTCTTTCTCTTTGAAGG - Intergenic