ID: 1036953904

View in Genome Browser
Species Human (GRCh38)
Location 8:13166783-13166805
Sequence AGCTGCACTTAGTATGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036953904_1036953915 16 Left 1036953904 8:13166783-13166805 CCCAGTTCATACTAAGTGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1036953915 8:13166822-13166844 GCAGGTGCTGGGACCTAGGTGGG No data
1036953904_1036953916 17 Left 1036953904 8:13166783-13166805 CCCAGTTCATACTAAGTGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1036953916 8:13166823-13166845 CAGGTGCTGGGACCTAGGTGGGG No data
1036953904_1036953917 26 Left 1036953904 8:13166783-13166805 CCCAGTTCATACTAAGTGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1036953917 8:13166832-13166854 GGACCTAGGTGGGGCCTGAGAGG No data
1036953904_1036953912 5 Left 1036953904 8:13166783-13166805 CCCAGTTCATACTAAGTGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1036953912 8:13166811-13166833 GGAGAAAGACTGCAGGTGCTGGG No data
1036953904_1036953913 12 Left 1036953904 8:13166783-13166805 CCCAGTTCATACTAAGTGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1036953913 8:13166818-13166840 GACTGCAGGTGCTGGGACCTAGG No data
1036953904_1036953911 4 Left 1036953904 8:13166783-13166805 CCCAGTTCATACTAAGTGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1036953911 8:13166810-13166832 GGGAGAAAGACTGCAGGTGCTGG No data
1036953904_1036953914 15 Left 1036953904 8:13166783-13166805 CCCAGTTCATACTAAGTGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1036953914 8:13166821-13166843 TGCAGGTGCTGGGACCTAGGTGG No data
1036953904_1036953910 -2 Left 1036953904 8:13166783-13166805 CCCAGTTCATACTAAGTGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1036953910 8:13166804-13166826 CTATGGGGGAGAAAGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036953904 Original CRISPR AGCTGCACTTAGTATGAACT GGG (reversed) Intronic
900230586 1:1555016-1555038 AGCAGCACTTAGCATGCTCTGGG - Intronic
905021979 1:34824167-34824189 GGCTGAGCTCAGTATGAACTAGG - Intronic
905110933 1:35594115-35594137 AGCTGCACTTTGAATGAATATGG + Intronic
908324635 1:63011733-63011755 AGCAGCACTTTGTATTAACGTGG + Intergenic
909994923 1:82267624-82267646 AGCTGGAGTTACTATGAAGTTGG - Intergenic
913520097 1:119637245-119637267 TGGTGCAGTTAATATGAACTAGG - Intronic
913658089 1:120980701-120980723 AGCTGCACTCAGTTTGCACCTGG + Intergenic
914522662 1:148431965-148431987 AGCTGCACTCAGTTTGCACCTGG + Intergenic
914648070 1:149672445-149672467 AGCTGCACTCAGTTTGCACCTGG + Intergenic
917105704 1:171489533-171489555 AGCTTCACTTATAATCAACTAGG - Intronic
919991003 1:202708866-202708888 AGCTGGACTTAGTCTTAAGTAGG + Intronic
921641024 1:217554359-217554381 AGCAGCATGTAGTATGAAATAGG + Intronic
923399110 1:233598913-233598935 AGCAACTCTTAGAATGAACTTGG - Intergenic
1066549657 10:36542602-36542624 AGCAGCATTTAGGATCAACTGGG + Intergenic
1073169666 10:101494143-101494165 AGCTGCTCTTAGAATGAATGTGG + Intronic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1081867577 11:46367909-46367931 AGCTGCCCTTTGTGTGCACTGGG - Intronic
1086274382 11:85108141-85108163 TTCTGCACTTAAAATGAACTTGG + Intronic
1088623742 11:111713377-111713399 ACCTCCTCTTAGTGTGAACTTGG + Intronic
1091145011 11:133271848-133271870 ATGAGCACTTAGTATGCACTCGG + Intronic
1091460367 12:639765-639787 AGCTGTACTTGATATGATCTAGG - Intronic
1093152949 12:15644932-15644954 AGCTGGACTTAATAGGAGCTAGG - Intronic
1096217241 12:49804648-49804670 GGCTCTGCTTAGTATGAACTGGG + Intronic
1096362331 12:50998784-50998806 AGCTGCAATTAATATAAACCAGG + Intronic
1097637506 12:62140732-62140754 AGCTGGTTCTAGTATGAACTGGG - Intronic
1097675441 12:62597365-62597387 AGCTCCACTTCTTATGAACAAGG - Exonic
1100177010 12:92042345-92042367 AGCTTCACTTAGTCTGTGCTGGG + Intronic
1101675628 12:106914025-106914047 AGCTGCGCTTAGAATCATCTTGG + Intergenic
1101794958 12:107964485-107964507 AGCTGCACTTCTTATGGCCTCGG - Intergenic
1103252060 12:119508513-119508535 AGTTGCATATAGTATGAGCTGGG + Intronic
1103585697 12:121953540-121953562 TGCTGCTCTTAGAAAGAACTTGG + Intronic
1105934859 13:25089420-25089442 AACTGCAGTTAGTAAAAACTTGG + Intergenic
1113043830 13:106132595-106132617 AGCTGAGATTAGTATGAAGTTGG - Intergenic
1115079705 14:29436027-29436049 AGCTGCCCTTAGTATGAGTTTGG - Intergenic
1124900958 15:33821937-33821959 AGCTGCCTTTAGTATGAGCAAGG + Intronic
1129059584 15:72849969-72849991 AGTTGCACTCAGAATGACCTGGG - Intergenic
1141606972 16:85159309-85159331 AGCTGGACTTTGTGTGACCTTGG + Intergenic
1147575066 17:41594283-41594305 AGCTGCATTTTGCCTGAACTGGG - Intergenic
1149032848 17:52103629-52103651 TGCTGCAGCTAGGATGAACTAGG + Intronic
1156117582 18:33804681-33804703 AGGTGCTCCTAGAATGAACTTGG - Intergenic
1157883983 18:51348578-51348600 GGCTGTACATAGTTTGAACTAGG + Intergenic
1157960979 18:52153074-52153096 AGCTGCAGTTAGAATGATCCGGG + Intergenic
1158073676 18:53503669-53503691 AGCTGCACTTTAAATGAACCTGG + Intronic
1158523280 18:58189513-58189535 AGATGCACTTGTTCTGAACTTGG - Intronic
1158814863 18:61083622-61083644 TGCTGGAATTGGTATGAACTTGG - Intergenic
925893436 2:8454266-8454288 AGCTGCATTTCATATAAACTTGG + Intergenic
928905583 2:36363874-36363896 TGCTGCAGTTGGTATAAACTAGG + Intronic
941253233 2:163194114-163194136 TGCAGCACTCAGTATGAACCAGG - Intergenic
941656801 2:168153237-168153259 AGTGGCACTTAGTAAGATCTTGG - Intronic
942280465 2:174358040-174358062 AGCTGTCTTCAGTATGAACTTGG - Intronic
943759090 2:191588974-191588996 AGCTGCCCTTTCTATGAACCAGG + Intergenic
944980541 2:205114534-205114556 AGCTGGATTTTGTATGACCTTGG - Intronic
946141927 2:217698712-217698734 AGCTGCACTCAGAATGGAATGGG + Intronic
1168962500 20:1878925-1878947 TGCAGCACTGAATATGAACTAGG + Intergenic
1174076404 20:47940516-47940538 AGCGGCACTTAGTGAGCACTTGG + Intergenic
1174958897 20:55133159-55133181 TGCTCCACTTAGTATCAACTAGG + Intergenic
1182884084 22:33758477-33758499 AGCTGCATTTAGTAGGGGCTGGG - Intronic
949651268 3:6162644-6162666 AGCAGCACTATTTATGAACTGGG - Intergenic
949975162 3:9449990-9450012 AGCTGCAAATAATATGAACTAGG + Intronic
950262575 3:11553564-11553586 AGCCGCACTGAGGATGAGCTCGG + Intronic
950950563 3:16993940-16993962 AGCTGTATTTAGAATGAATTTGG + Intronic
951117395 3:18880882-18880904 AGCTGCACATAATATGAGCTGGG + Intergenic
953619842 3:44523667-44523689 AGCTGCACTTAGAAAACACTGGG + Intergenic
955979706 3:64512531-64512553 ACCTCCACTTAGTATGAGCTGGG + Intergenic
956110273 3:65863399-65863421 AGCTGGAATGAGTAGGAACTTGG + Intronic
957684999 3:83491612-83491634 ATTTGCTCTTAGTATGAACTAGG + Intergenic
960836593 3:121912972-121912994 AGGTGCATTTAGTATCAACATGG + Intronic
964630164 3:158801809-158801831 AGCTGCGCTGAGTCTGAAATAGG + Intronic
964673098 3:159248562-159248584 GGCTGCACTTAGAATCAGCTGGG + Intronic
965625260 3:170678295-170678317 AGCTACTCTCAGTAAGAACTTGG - Intronic
965696814 3:171417416-171417438 AGATGCATTTAGTATGAATGGGG - Intronic
966132261 3:176654425-176654447 AGCTGCATTTAGGATAAACCGGG - Intergenic
974279035 4:59766282-59766304 AGGTGCAATTAGTGTCAACTGGG + Intergenic
977423519 4:96835088-96835110 AACTGCACTTAGGAGGATCTAGG - Intergenic
977570511 4:98624357-98624379 TGCTGCACTTAGTCTGTACTTGG - Intronic
977652600 4:99487413-99487435 AGCTGAACATAGTATGACCATGG + Intergenic
982226397 4:153171282-153171304 AGTTTCACTCAGTATGAATTGGG + Intronic
982275472 4:153632824-153632846 AGCTGTACCTATTATGAACCGGG - Exonic
983979199 4:173973435-173973457 TGCTGCACTGAGCATTAACTCGG - Intergenic
984589386 4:181600473-181600495 AACTTGACTTAGTCTGAACTTGG - Intergenic
990730736 5:58806303-58806325 AGCAGCACTTACTATGTACTAGG - Intronic
991639949 5:68742213-68742235 AGCTGACTGTAGTATGAACTAGG - Intergenic
995289283 5:110431483-110431505 TGCTGTACATAGTATGAACCAGG + Intronic
995850212 5:116537031-116537053 GGCTGCTCTTATTATGGACTTGG - Intronic
1003856890 6:10285653-10285675 ATCTGCACTTATTAAGGACTGGG - Intergenic
1006354142 6:33543977-33543999 AGCTCCACTTGGAATGAACTGGG + Intergenic
1008179777 6:48314314-48314336 ATTTGTACTAAGTATGAACTAGG + Intergenic
1010515125 6:76763137-76763159 AGCTGCATTTGGTATTAGCTAGG - Intergenic
1010579516 6:77577092-77577114 AGAAGCACTTATTATGGACTGGG + Intergenic
1012187638 6:96239878-96239900 AGCTGCACTTACTCTCAAATTGG + Intergenic
1012245080 6:96917223-96917245 AGCTGGACTTAGGATAACCTAGG + Intergenic
1014003633 6:116392499-116392521 AGCTGCTCTTAGGCTGAGCTTGG + Intronic
1022383056 7:29878635-29878657 AGCTGCTCTTATTTTCAACTTGG - Intronic
1024194626 7:47047071-47047093 AGAAGCACAAAGTATGAACTTGG + Intergenic
1026409791 7:70108185-70108207 GGCTGCACTTGAAATGAACTGGG + Intronic
1032527401 7:132589639-132589661 AGCAGTACTTGGTATAAACTAGG - Intronic
1036953904 8:13166783-13166805 AGCTGCACTTAGTATGAACTGGG - Intronic
1039051270 8:33496417-33496439 ATCTGCAGTTAGTATCAAATAGG - Intronic
1039186723 8:34925715-34925737 AGCTGGACTTGGGATGAGCTGGG + Intergenic
1040079050 8:43269604-43269626 AGCTGCAGTGGGTTTGAACTGGG - Intergenic
1042101348 8:65278782-65278804 ATCTTCACTAAGTATGGACTAGG + Intergenic
1045297863 8:100888071-100888093 AGCTGCATTCATTATTAACTGGG - Intergenic
1050613169 9:7374268-7374290 AACTGTCCTTAGTATGATCTTGG + Intergenic
1051441870 9:17093428-17093450 AGCTGCATTTGGAATGAAATGGG - Intergenic
1057523564 9:95780036-95780058 AGATGCACTTAGTGTGAATCAGG + Intergenic
1057538618 9:95942779-95942801 AGGGGCATTTAGTATGAAGTAGG + Intronic
1058552694 9:106132374-106132396 AACTGCAATTAGCATGAACTAGG - Intergenic
1058989336 9:110240118-110240140 GGCAGCACTTAGAATCAACTAGG - Intergenic
1186002592 X:5029732-5029754 AGCTGCACTTTGTTTTAATTTGG + Intergenic
1186528608 X:10272842-10272864 AGCTGCACATACTAGGAACTGGG - Intergenic
1186883290 X:13887728-13887750 GGCTGCACTTAGAATCACCTGGG + Intronic
1190788275 X:53675082-53675104 AGCTGTACTTCATATAAACTAGG - Intronic
1197171832 X:123443467-123443489 ATCTTCAATTAGTATGACCTAGG + Intronic
1198552666 X:137761046-137761068 AGCTGCTGCTAGTTTGAACTTGG - Intergenic
1199390775 X:147275718-147275740 ATCTGCACTTGGTATGAGCATGG - Intergenic
1201301056 Y:12505206-12505228 AGCAGCACTTCCTATGCACTAGG - Intergenic
1201693861 Y:16801307-16801329 AAGTGCACTTACTATAAACTAGG - Intergenic