ID: 1036963423

View in Genome Browser
Species Human (GRCh38)
Location 8:13270582-13270604
Sequence CTGATTCCACACATTGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036963423_1036963425 2 Left 1036963423 8:13270582-13270604 CCCTCATCAATGTGTGGAATCAG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1036963425 8:13270607-13270629 ATTCTCCAGTCATTTCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036963423 Original CRISPR CTGATTCCACACATTGATGA GGG (reversed) Intronic
902195772 1:14796883-14796905 CTGAGTCCACTCAGTGGTGAGGG + Intronic
902322238 1:15676042-15676064 CTGATTCAACACAATTATGTTGG - Intergenic
902541490 1:17158767-17158789 CTGCTTCCACTCATGGAGGAAGG - Intergenic
905214830 1:36399713-36399735 ATGCTTTCACACATTAATGAAGG - Intergenic
907547864 1:55277766-55277788 TTGATTCCTAACATTGGTGACGG - Intergenic
907657084 1:56355001-56355023 TTGATTCCTCATTTTGATGATGG - Intergenic
908076395 1:60524289-60524311 CTGTATCCTCACATTGCTGAGGG + Intergenic
908816608 1:68041970-68041992 ATGATTCCAGACATGGATGGAGG - Intergenic
911476626 1:98381304-98381326 ATGCTTGCCCACATTGATGAGGG + Intergenic
913467776 1:119159892-119159914 CTGATTTGACACTCTGATGAGGG + Intergenic
916280898 1:163049971-163049993 ATGATTCCACACTTTGATTAAGG - Intergenic
917154478 1:171981959-171981981 CTGACTACTCACATTGATGCTGG + Intronic
918501974 1:185207337-185207359 CTGCTGCCACAGATGGATGATGG + Intronic
919987387 1:202685367-202685389 CTGATTCTCCACATTGCTAATGG - Intronic
921578794 1:216871691-216871713 ATGTTTCCACATATTGATAAAGG - Intronic
921910220 1:220540405-220540427 ATGCTTGCCCACATTGATGAAGG + Intronic
922990886 1:229910164-229910186 CTGTTTCCACACATGGTGGAAGG - Intergenic
923289973 1:232535309-232535331 CTGAAGCCAGACATTCATGAAGG - Intronic
923927002 1:238641325-238641347 CTGAGTGCTCACATTTATGAGGG + Intergenic
924021585 1:239789535-239789557 CTGCTTCCACTCATGGAGGAAGG + Intronic
1066038981 10:31525706-31525728 ATGAATCCACAGATTGAAGAAGG - Intronic
1070419977 10:76226768-76226790 CTGATTCCACTCATGGAGGAAGG - Intronic
1071758085 10:88568388-88568410 CTAATTACAGACATTGATAATGG + Intronic
1074673005 10:115816785-115816807 CCCATTCCTCACAGTGATGAGGG - Intronic
1074982669 10:118632291-118632313 CTGCTTCCACTCATGGAAGAAGG - Intergenic
1075894755 10:125985297-125985319 CAGATGCCACACATTATTGAGGG + Intronic
1076286847 10:129307808-129307830 CTGATTCAACACTTTCATGATGG - Intergenic
1076368399 10:129936556-129936578 CTGGTTCCCCACATAGCTGAGGG - Intronic
1076623397 10:131807354-131807376 CAGCTTCCAGACATGGATGAGGG + Intergenic
1079819149 11:25103470-25103492 CTGTTTCCTCACATTGAAGAAGG - Intergenic
1081491074 11:43569432-43569454 CTGCTTCCACCCATAGCTGAGGG - Intronic
1087334814 11:96830212-96830234 CTGCTTCCACTCATGGAGGAAGG - Intergenic
1090251669 11:125255966-125255988 CTGATTCCAGATTTTGATGAAGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091336799 11:134776319-134776341 CTGATTCCACAGCTAGATAAGGG + Intergenic
1091458494 12:626235-626257 CTGTGTCCACCCAGTGATGAGGG + Intronic
1093696723 12:22169488-22169510 CTGCTTCCACACATGGCAGAAGG + Intronic
1093798567 12:23343761-23343783 CTGCTTCCTCACATGGAAGAAGG - Intergenic
1094126433 12:27027713-27027735 CTGTTTCCTCACATGGCTGAAGG + Intronic
1097710729 12:62914278-62914300 CTGCTTCCACTCATGGTTGAAGG - Intronic
1100040663 12:90313340-90313362 CTGAATGCACACATTAAAGAAGG + Intergenic
1100258548 12:92909251-92909273 CTGATTCCAGACATGGGAGAGGG + Intronic
1101799904 12:108012331-108012353 GTGATTCGACACTCTGATGATGG + Intergenic
1102467580 12:113138915-113138937 CAGATTCCAGACATGGATGAAGG + Intergenic
1103884823 12:124192445-124192467 CTTATTCACCACACTGATGAAGG + Intronic
1104272126 12:127292130-127292152 ATGCCTGCACACATTGATGAGGG - Intergenic
1105005765 12:132719661-132719683 CTGAGTCCACACAGTGGTGAGGG + Intronic
1107980093 13:45727078-45727100 CTGCTTCCACACATGGAGAAAGG + Intergenic
1110594080 13:77298923-77298945 CTGATGCTTCACATTGATGCAGG - Intronic
1111384017 13:87499798-87499820 CTGATACAATAAATTGATGATGG - Intergenic
1113050456 13:106205829-106205851 CTGCTTCCACTCATGGAGGAAGG + Intergenic
1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG + Intronic
1115214771 14:31003615-31003637 CTGCTTCCACTCATGGCTGAAGG - Intronic
1115909421 14:38239173-38239195 CTGAGTCAACACATGGAAGATGG + Intergenic
1116886640 14:50228520-50228542 TTGATTCAGCCCATTGATGAGGG - Intronic
1118393744 14:65318071-65318093 CTGGTCACACACATTGATGATGG - Intergenic
1118626304 14:67662570-67662592 CTGTTTCCACACATTTGTAAAGG + Intronic
1118951663 14:70441193-70441215 CTGTTTCCACACAGTCATGGAGG + Intergenic
1119115322 14:72015157-72015179 CTGCTTCCACTCATGGAGGAAGG + Intronic
1120226073 14:81792141-81792163 CACATTCAACAAATTGATGAAGG + Intergenic
1121230334 14:92352866-92352888 CTTATTCCATAGATGGATGATGG - Intronic
1122123871 14:99568834-99568856 CTGACTCTCCACATTGTTGATGG - Intronic
1122562981 14:102630295-102630317 CTGCTTCCACACATGGCGGAAGG - Intronic
1124819039 15:33024601-33024623 AGAATTCCACACATTGTTGATGG + Intronic
1126063842 15:44810048-44810070 CTGAGTCCACACACAGGTGAAGG + Intergenic
1126638084 15:50798718-50798740 TTGATTCCCAACATTGATTATGG + Intergenic
1130210246 15:81915709-81915731 CTGCGTCCTCACATAGATGAAGG + Intergenic
1130396005 15:83502214-83502236 CCATTTCCACACACTGATGAGGG - Intronic
1131071032 15:89466107-89466129 CTCTCTCCACCCATTGATGATGG + Intergenic
1131965141 15:97834356-97834378 CTGATTCAATTCATGGATGAGGG - Intergenic
1133501996 16:6375591-6375613 ATGATTCCACACATTACAGAAGG - Intronic
1134773730 16:16833667-16833689 CTGATTCTACAGTTTGAAGATGG + Intergenic
1135830716 16:25770478-25770500 CTCAGGCCACACATTGAGGAAGG + Intronic
1138321676 16:56119422-56119444 CTGATTCCAGACTTTAATGGAGG - Intergenic
1138612581 16:58138427-58138449 CTGTTTCCACACATTGCAGAAGG - Intergenic
1141470688 16:84236461-84236483 CTGAGTCCACGCATGGCTGAGGG + Intronic
1144733996 17:17544813-17544835 CCAATTTCACACATGGATGATGG - Intronic
1148185284 17:45638660-45638682 ATGATACCACACATTTATCATGG - Intergenic
1151123350 17:71817756-71817778 CTGCTTCCACTCATGGAGGAAGG - Intergenic
1153356807 18:4145938-4145960 CTGGTTCTATACATTGCTGATGG - Intronic
1153841573 18:9012734-9012756 CTGCTTCCACACATGGTGGAAGG + Intergenic
1156221909 18:35061422-35061444 CTGACTTCACACAAGGATGATGG - Intronic
1156930853 18:42641308-42641330 TTTAGACCACACATTGATGATGG - Intergenic
1158162171 18:54497311-54497333 CTAATTCCACACCTGAATGAGGG + Intergenic
1158499704 18:57989385-57989407 CTGATTCCTCACATGGCAGACGG - Intergenic
1160268428 18:77361488-77361510 CTAAACCAACACATTGATGATGG - Intergenic
1160574880 18:79847577-79847599 CTTATTACATACATGGATGAGGG - Intergenic
926562490 2:14433529-14433551 CTGATTCCATTTTTTGATGACGG - Intergenic
926730930 2:16034846-16034868 CTGTTTGGACACATTGATCAAGG + Intergenic
930204318 2:48572973-48572995 CTGCATCCACACATTCCTGAGGG - Intronic
931274751 2:60734628-60734650 CTGATTCCAAACATGTAGGATGG - Intergenic
932477414 2:72014896-72014918 ATGATTCCACCCATTACTGAAGG - Intergenic
934728828 2:96643212-96643234 CTGCTTCCTCAGATTGATGCGGG + Intergenic
935873934 2:107485756-107485778 CTGATTCCACTCATGGCAGAAGG - Intergenic
935946557 2:108291704-108291726 CAGCTTCCTCACATTTATGAGGG + Intronic
937282785 2:120731751-120731773 CTGAGTCCTCACATGGAGGAAGG - Intergenic
937347762 2:121137204-121137226 CAGATGCCACACCTGGATGAGGG - Intergenic
942379439 2:175373332-175373354 CTGATTACACAGATTGACTAAGG - Intergenic
943705008 2:191025336-191025358 CTGATTCCACTTATGGAGGAAGG - Intergenic
945810816 2:214547928-214547950 CTGAGTCCACAAATACATGAAGG + Intronic
946680814 2:222213755-222213777 CTGATTCTTCACAATGATAAAGG + Intronic
946986229 2:225276678-225276700 ATGATTTCACTCATTGATGAGGG - Intergenic
1170676006 20:18481652-18481674 CTGAATACACTCATTTATGATGG + Exonic
1172730489 20:37083111-37083133 CTGAATGAACACATTGATGCTGG + Intronic
1174437768 20:50523207-50523229 CTGTGTCCCCACCTTGATGAGGG - Intronic
1175002636 20:55645687-55645709 CTGATTCTTCACATTGGTAATGG - Intergenic
1175693735 20:61085390-61085412 CTGATTCCTCACTTTCCTGATGG + Intergenic
1176913743 21:14599725-14599747 CTGCTTCCACTCATGGCTGAAGG - Intronic
1178375579 21:32064962-32064984 CTGTTTCCACACATAGTTGGGGG - Intergenic
1178629344 21:34245676-34245698 CTGATTCTATACATGGACGATGG - Intergenic
949276416 3:2288289-2288311 CTGCTTCCACTCATTGTGGAAGG + Intronic
949748133 3:7319121-7319143 CTGATTCCCCAAATTAATCATGG - Intronic
950437656 3:12990281-12990303 CTCACTCCACACACCGATGAGGG + Intronic
951646542 3:24898128-24898150 TTGAGTCCACACATTGTTGGTGG + Intergenic
951953080 3:28223432-28223454 TTGATTAAACACATTGATGAGGG - Intergenic
960308699 3:116093950-116093972 CTGATTCCACATTTTAATGCTGG - Intronic
961187611 3:124929524-124929546 CTGATTCTTCACCTTGAAGAGGG + Intronic
961268657 3:125671209-125671231 ATGATTTCACACATTTATGTGGG + Intergenic
962459565 3:135596990-135597012 CTTATTCCACACAATGCTTATGG + Intergenic
963138103 3:141925941-141925963 CTGATTCCAAACATGTAGGATGG + Exonic
967595055 3:191318053-191318075 TTGATTCCACATTTTGATGGAGG + Intronic
968423587 4:505708-505730 CTGACTGCAGGCATTGATGACGG + Exonic
972688215 4:41371395-41371417 ATGGTTCCACCCACTGATGATGG - Intronic
974308821 4:60176566-60176588 CTGAGTCCTCACATGGAAGAAGG - Intergenic
976463822 4:85344562-85344584 CTGCTTCCACTCATTGTGGAAGG - Intergenic
976879072 4:89896303-89896325 CTGATTCATCATATTCATGATGG - Intronic
978457973 4:108916220-108916242 ATGATTTCACACTTTTATGAAGG - Intronic
979253034 4:118585212-118585234 CTGATTCCACTCATAGTGGAAGG + Intergenic
984157502 4:176209935-176209957 CAGATTCCACCCATTGTGGAAGG + Intergenic
984419466 4:179501685-179501707 CTGCTTCTACACATTGCAGAAGG + Intergenic
985979183 5:3448323-3448345 CTGTTTCCAGACATTGCTGAAGG + Intergenic
990434337 5:55772769-55772791 CTGCTTCCACCCATGGCTGAAGG - Intronic
990973422 5:61535135-61535157 CTGATGCCACACATTGAGAGAGG + Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
993297494 5:86161145-86161167 CTGACTGCAAACATTCATGAAGG + Intergenic
995825352 5:116291015-116291037 CTGAGTCTATACATTGAAGAAGG + Intronic
996000455 5:118355887-118355909 CTGATTACCCCCATTGATGAAGG + Intergenic
996988699 5:129601715-129601737 ATGATTTCACACATTGTTGTTGG - Intronic
997317395 5:132948949-132948971 CTGATTCCACACAATGTTTATGG + Intronic
997903485 5:137790600-137790622 CTAATCCCATTCATTGATGAGGG + Intergenic
997991137 5:138545148-138545170 CTGTGTCCACACTTTGAAGATGG + Intergenic
999927017 5:156389925-156389947 CTTATGCCACATATTGATAATGG + Intronic
1001729908 5:173945119-173945141 TTGCCTCCAGACATTGATGAAGG + Exonic
1002343609 5:178532927-178532949 TTGATTCCACACAGTTCTGAAGG - Intronic
1002459496 5:179365974-179365996 CTGCTTCCACTCATGGAGGAAGG - Intergenic
1003392574 6:5726434-5726456 CTGAAACCACACATGCATGATGG + Intronic
1003395902 6:5751722-5751744 CTGATTCCACACAGTGACCCTGG + Intronic
1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG + Intronic
1008032300 6:46710597-46710619 CTGATTCTTGACATTGATCATGG - Exonic
1011656539 6:89557084-89557106 CTGTGTCCTCACCTTGATGAGGG - Intronic
1012491238 6:99784640-99784662 CATATACCACACATTGCTGATGG + Intergenic
1014301746 6:119690293-119690315 CTGTTTCCTCACATAGTTGAAGG - Intergenic
1015211932 6:130708557-130708579 CTGCTTCCACTCATTGCAGAAGG + Intergenic
1021346074 7:19530051-19530073 CTATTTCCACACATTTGTGATGG + Intergenic
1021613957 7:22483312-22483334 GTTATTCCACATATGGATGAGGG + Intronic
1024158081 7:46646945-46646967 CTGATGCTACTCATTGATGATGG - Intergenic
1026719817 7:72820760-72820782 TTGATCCCTCACATTGGTGATGG - Intronic
1027507502 7:79036039-79036061 CTGACTCCTCACATTTCTGATGG - Intronic
1029819573 7:103132932-103132954 CTGTTTCCACAGATTGATTGGGG - Intronic
1031300487 7:120057243-120057265 CTGTTTCCACACAGTCATGAAGG + Intergenic
1032872293 7:135999238-135999260 CTGCTCCATCACATTGATGAAGG - Intergenic
1034048299 7:147953419-147953441 CTCATTCCATACCTAGATGATGG + Intronic
1034543969 7:151777576-151777598 CTGCTTCCACTCATGGAGGAAGG - Intronic
1034726442 7:153340554-153340576 CTGCTTCCACTCATGGAGGAAGG + Intergenic
1035124488 7:156597776-156597798 TAGAAGCCACACATTGATGATGG - Intergenic
1036963423 8:13270582-13270604 CTGATTCCACACATTGATGAGGG - Intronic
1037393749 8:18420686-18420708 CTGCTTCCACACATGGTGGAAGG - Intergenic
1038607583 8:29024130-29024152 CTGCTGCCACACATTTGTGAGGG - Intronic
1038939440 8:32287314-32287336 TGGATTCCACACCTTGATGGAGG + Intronic
1039751105 8:40479615-40479637 CTGATTCTCCACCTTGCTGATGG - Intergenic
1042851146 8:73217172-73217194 CTGTTTCCCCACATGGCTGAAGG - Intergenic
1043181030 8:77086920-77086942 CTGATTTGACTCTTTGATGAGGG + Intergenic
1050101016 9:2119810-2119832 CTGTTTCCACACAAAGATGTGGG - Intronic
1050397093 9:5210503-5210525 CAGATTCACCACTTTGATGAGGG - Intergenic
1051091638 9:13416570-13416592 CTGATTCCCCACCTTTCTGAAGG - Intergenic
1051590543 9:18772923-18772945 GAGATTCCAAACATTGAGGAGGG + Intronic
1054731711 9:68707351-68707373 CTAATTCCAAACATTTCTGAGGG + Intronic
1055418807 9:76114001-76114023 CTGATTCCACACAGTTACAAGGG + Intronic
1058918799 9:109593674-109593696 CTGCTTCCACTCATGGAGGAAGG + Intergenic
1188295349 X:28440758-28440780 CTGCTTCCACACATGGTGGAAGG - Intergenic
1194091101 X:89582502-89582524 CTGTTTCCACACAGTCATGGAGG + Intergenic
1195574938 X:106439023-106439045 CAGATTCCACAGATTGGGGAGGG - Intergenic
1195879420 X:109576769-109576791 GTGATGCCACACATTGGGGAGGG - Intergenic
1196810768 X:119627465-119627487 GTCATTCCACAGATTGAGGATGG + Intronic
1199330539 X:146553014-146553036 CTGCTTCCACTTATTGGTGATGG + Intergenic
1199872243 X:151910027-151910049 CTGATTCCACCAAATGATCAAGG + Intergenic
1200443743 Y:3238564-3238586 CTGTTTCCACACAGTCATGAAGG + Intergenic
1200681335 Y:6215092-6215114 CATATTCCACAAATTGATGCTGG + Intergenic
1202168522 Y:22017090-22017112 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202222839 Y:22569278-22569300 CTGTTTCCACAGAGTCATGAAGG + Intergenic
1202320276 Y:23626382-23626404 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202550491 Y:26043674-26043696 CTGTTTCCACAGAGTCATGAAGG + Intergenic