ID: 1036963903

View in Genome Browser
Species Human (GRCh38)
Location 8:13275656-13275678
Sequence TGGTGCAATTCAAGTGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036963903_1036963905 16 Left 1036963903 8:13275656-13275678 CCTAGAGCACTTGAATTGCACCA 0: 1
1: 0
2: 0
3: 4
4: 123
Right 1036963905 8:13275695-13275717 ATATTTCAAACGCCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036963903 Original CRISPR TGGTGCAATTCAAGTGCTCT AGG (reversed) Intronic
900936330 1:5768544-5768566 TGGAGCAATGCAGGTGCTGTTGG - Intergenic
902068292 1:13708314-13708336 TGGTGTTATTTAATTGCTCTAGG + Intronic
904851493 1:33463029-33463051 TGGTGCAAACCTAGTCCTCTGGG + Intergenic
906614968 1:47227762-47227784 TGGTGCATTTCCAGTGGCCTTGG - Intronic
907153462 1:52310226-52310248 TGGTGCAATCCAAGCACTTTGGG - Intronic
907700734 1:56785532-56785554 AGACGCAATTCATGTGCTCTGGG - Intronic
909722293 1:78788654-78788676 TGGTACAATTGAATTGATCTTGG + Intergenic
911739422 1:101370744-101370766 TGGTGCAATTCAAGAGATAAAGG - Intergenic
917515830 1:175707162-175707184 TAGTGCTTTTAAAGTGCTCTAGG - Intronic
917857020 1:179109110-179109132 TGGTGCCACCCAAGTGCTATGGG - Exonic
918406222 1:184214059-184214081 CGGCGCAAACCAAGTGCTCTGGG - Intergenic
919221521 1:194635832-194635854 TGTTGCAATTTAAGAGTTCTTGG + Intergenic
920047792 1:203144978-203145000 GTGTGCAATTCAACTGCTGTGGG + Intronic
920913158 1:210235973-210235995 AGCTGTAATTCATGTGCTCTTGG + Intronic
920928048 1:210361413-210361435 CAGTGCAATCCAAGTGATCTGGG - Intronic
922674181 1:227541011-227541033 TGGTGCAAATCAAGTCCCCAAGG + Intergenic
924435541 1:244037403-244037425 TTTTACAATTAAAGTGCTCTCGG + Intergenic
1065828287 10:29591815-29591837 TGGGGAGATCCAAGTGCTCTGGG + Intronic
1067939260 10:50639697-50639719 TCTTGCAATTCCAGTGCTTTGGG - Intergenic
1073842232 10:107510889-107510911 TTGAGAAATTAAAGTGCTCTGGG + Intergenic
1077791686 11:5447783-5447805 TGGTTCAATTCCAGTGGCCTTGG + Intronic
1078313120 11:10266318-10266340 TTGTGCAATTAAAGACCTCTCGG + Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1086429179 11:86718819-86718841 TGGAGAAATTCAGGTGCTTTGGG - Intergenic
1088981200 11:114865776-114865798 TGCTGCATTTCAGGTGTTCTTGG - Intergenic
1090773770 11:129945632-129945654 TGGTGCAAACCGAGTGCTCTTGG - Intronic
1091024744 11:132132091-132132113 TGATGCAGTTCAAGTGCCCGAGG + Intronic
1093298330 12:17419333-17419355 TGGTGAAATTTAAGTGTTCAAGG - Intergenic
1093755461 12:22846992-22847014 TGGTGTAATACAATTTCTCTAGG + Intergenic
1099077533 12:78129862-78129884 TGATGGAATTGATGTGCTCTGGG - Intronic
1099247950 12:80216387-80216409 TGGTGAAATATAAGTGCTATTGG + Intronic
1102662481 12:114541774-114541796 GTGTGCAATTCAATTGCTTTTGG - Intergenic
1102665259 12:114566527-114566549 GTGTGCAATTCAATTGCTTTTGG + Intergenic
1102932519 12:116873705-116873727 GGGTGGAATTTAATTGCTCTGGG - Intronic
1104992813 12:132635612-132635634 TGGTGCACTTCATCAGCTCTCGG + Intronic
1105669103 13:22592620-22592642 TGGTGAAAATCAAATGCTCAAGG + Intergenic
1111403184 13:87768348-87768370 TGGTGCATTTCAAGTTCTGACGG - Intergenic
1111659702 13:91193692-91193714 GGGTGCAATTCAGGTGTTGTGGG + Intergenic
1113210153 13:107968859-107968881 TGGTGCAAGTAAAGTGTTCAGGG + Intergenic
1113374163 13:109748816-109748838 AGGTGCACTTTATGTGCTCTAGG + Intergenic
1117027295 14:51634546-51634568 TCATGAAATTCAAGTACTCTTGG + Intronic
1120113547 14:80586443-80586465 TGGTCCAATTCAAAAGCCCTGGG - Intronic
1126875158 15:53033517-53033539 GGGTGCCATTCACTTGCTCTAGG + Intergenic
1127787546 15:62369317-62369339 AGGTGCAATGAAACTGCTCTGGG - Intergenic
1128178690 15:65580950-65580972 TGGTGCAATAAAAATGTTCTGGG + Intronic
1128762317 15:70225715-70225737 TGCTGCTATTCAAGCGTTCTTGG + Intergenic
1133271439 16:4612663-4612685 TGCTGCAATTCAGGTGCTAATGG - Intronic
1139283932 16:65793890-65793912 TGGTGCAGAGCAGGTGCTCTAGG - Intergenic
1142125936 16:88410653-88410675 TGGTGCAAGTCACGTGGTCATGG + Intergenic
1146044680 17:29494268-29494290 TGGTGTAATTCCAATGCTTTGGG + Intronic
1154974575 18:21444619-21444641 TGGTGCAATTCATCTCCTCTAGG - Intronic
1155534915 18:26807090-26807112 TGGTGCATAGCAAGTGCTCATGG + Intergenic
1164011002 19:21203404-21203426 TAGTGAAATACAAGTCCTCTTGG - Intergenic
1166942197 19:46373883-46373905 AGGTGCAAATGAGGTGCTCTGGG + Intronic
1167489870 19:49786430-49786452 CGCTGCAGTTCCAGTGCTCTGGG + Intronic
925721416 2:6831745-6831767 TGTTGCAAATAAACTGCTCTGGG - Intergenic
932124615 2:69132496-69132518 TGGTGAAATTCAAGAGATTTTGG - Intronic
933316396 2:80720475-80720497 TGTTGCCATTTAAGTGTTCTTGG - Intergenic
934138571 2:89021725-89021747 TGATGCATTTCAAATTCTCTGGG + Intergenic
934230673 2:90178838-90178860 TGATGCATTTCAAATTCTCTGGG - Intergenic
935132122 2:100268638-100268660 TGGTGGATTTCAAGGACTCTGGG - Intergenic
935135636 2:100298514-100298536 TGGTGCACTTAATGTGCTCCAGG - Intronic
936001513 2:108835455-108835477 TGGTGAATTTCATTTGCTCTGGG - Intronic
944666502 2:201963504-201963526 GGGAGCAATTCATCTGCTCTTGG + Intergenic
1169492682 20:6084386-6084408 TGGTGCAGTTGGAGAGCTCTGGG + Intronic
1171004808 20:21454089-21454111 CGGTTCAAATCAAGTGCTGTGGG + Intergenic
1172196594 20:33096053-33096075 GGGTGGAATTCAAAGGCTCTAGG + Intronic
1173218216 20:41107988-41108010 TGTAGCAATGTAAGTGCTCTAGG - Intronic
1175522483 20:59610983-59611005 TGCTGCATTGCAGGTGCTCTGGG - Intronic
1175800304 20:61797529-61797551 TGTTGCAATGCCAGTGCTTTGGG + Intronic
1180145928 21:45918812-45918834 TGGTGTAATTCCAGTGCTGAGGG + Intronic
1180145935 21:45918860-45918882 TGGTGTAATTCCAGTGCTGGAGG + Intronic
1184734546 22:46390421-46390443 TGGTACAGTTAAAGAGCTCTGGG + Exonic
949452878 3:4206384-4206406 TGGTCCAGCTAAAGTGCTCTAGG - Intronic
952650754 3:35724282-35724304 AGGTGTCATTCAAGTGCTTTCGG - Intronic
953093561 3:39753225-39753247 TGCTTCTATTCAAGTTCTCTGGG - Intergenic
954113742 3:48451904-48451926 TGGTGCAAAACAAATGCTCTGGG - Intronic
955411592 3:58658936-58658958 TGGGGCAATGCATGTGATCTTGG + Intronic
956333952 3:68142709-68142731 GGGTGTATTTAAAGTGCTCTTGG - Intronic
961259680 3:125591552-125591574 TGGTGCAATTCAGTTCCTTTTGG - Intronic
961779374 3:129312854-129312876 GGGTGCCTTTTAAGTGCTCTTGG + Intergenic
965639326 3:170815939-170815961 TGGTGGCATTCTATTGCTCTGGG - Intronic
966675161 3:182577883-182577905 TGGTGCAATTCCATTTGTCTAGG - Intergenic
970724613 4:19029049-19029071 TGGTTATATTCAAGTACTCTAGG - Intergenic
976734058 4:88292811-88292833 TTCTGCAATCCAAGTGCTTTGGG + Intergenic
979103030 4:116646912-116646934 TAGTGCAAATCAAGTACTTTTGG - Intergenic
979301864 4:119095624-119095646 TGGTGAAAATTAAATGCTCTTGG - Intergenic
983039680 4:162910595-162910617 TAGGGCAATTCAAGTGCTAATGG + Intergenic
988823594 5:34912637-34912659 TGGTGAAATTGAATTGCTGTGGG - Intronic
988977475 5:36529217-36529239 AGCTGCAATTTAAGTGCACTGGG - Intergenic
990087476 5:51996394-51996416 TAGTGCAATTTAATTGCTTTAGG + Intergenic
991329794 5:65481856-65481878 TGCTGCAATTCAAGTTGGCTGGG - Exonic
993516257 5:88838888-88838910 TTGTGCAATTCAAGCTCTTTAGG + Intronic
996560406 5:124822289-124822311 TGCTGCAATTCTAATGCCCTGGG + Intergenic
999606039 5:153317361-153317383 TGGTTCAATTCAAGAGCTTAAGG + Intergenic
1000293832 5:159895813-159895835 TGGTCCAATTTCAGTGCTCCCGG + Intergenic
1007287525 6:40758328-40758350 TGGCTCCATTGAAGTGCTCTAGG - Intergenic
1014911626 6:127100896-127100918 TAATGCATTTCAAGTGCTGTTGG - Intergenic
1015951073 6:138553030-138553052 TGGTGCAATTGGAGTTCTTTTGG - Intronic
1016478396 6:144453812-144453834 TGGTTTAATTCATCTGCTCTGGG - Exonic
1016963730 6:149698503-149698525 TCTTGTAATTCCAGTGCTCTGGG - Intronic
1026507136 7:70994521-70994543 TGGCCCAATTCAATGGCTCTGGG - Intergenic
1034300082 7:150007747-150007769 TAGTGCAAGTCACCTGCTCTGGG + Intergenic
1034805963 7:154089563-154089585 TAGTGCAAGTCACCTGCTCTGGG - Intronic
1036963903 8:13275656-13275678 TGGTGCAATTCAAGTGCTCTAGG - Intronic
1037404206 8:18524089-18524111 TGGAGCAGTTCAAGTGTGCTTGG - Intergenic
1039277280 8:35947102-35947124 AGGTGCAAGTTAAGTTCTCTTGG - Intergenic
1040654109 8:49484570-49484592 TGGTGCCATTCATGGGCTGTGGG - Intergenic
1042837907 8:73093553-73093575 TGGTGCCCATCGAGTGCTCTTGG - Intronic
1043670842 8:82882145-82882167 TGGTACCAATCAGGTGCTCTGGG - Intergenic
1043678065 8:82986330-82986352 TGGTTCAAATCAAGTGCATTAGG - Intergenic
1052901157 9:33795910-33795932 TGGTGCTATACTGGTGCTCTTGG - Intronic
1056121099 9:83490005-83490027 TGGGGGAATTCAAGTTCTCTAGG - Intronic
1059420381 9:114186883-114186905 TGGTGCAAATGAGGAGCTCTAGG + Intronic
1059861903 9:118473791-118473813 CTCTGCAAGTCAAGTGCTCTGGG + Intergenic
1186869116 X:13752371-13752393 TGATTCAACTCAGGTGCTCTGGG + Intronic
1189649549 X:43174850-43174872 TGTTGCATTTCAAATGCTCCAGG - Intergenic
1191126907 X:56966053-56966075 TGGAGAAATCCAAGTGCTTTAGG + Intergenic
1196681138 X:118470829-118470851 TGGTGCATTTACAGTCCTCTAGG - Intergenic
1197528250 X:127589304-127589326 TAGTTCAATTCAAATGTTCTAGG - Intergenic
1198282129 X:135152825-135152847 TGGTGCAATTCATGTACACAAGG - Intergenic
1198284429 X:135175810-135175832 TGGTGCAACTCATGTGCACGAGG - Intergenic
1198288830 X:135219697-135219719 TGGTGCAATTCATGTACACAAGG + Intergenic
1199255369 X:145713407-145713429 TGGTACAATTAAAGTGTTCCTGG + Intergenic
1199543516 X:148983590-148983612 TGGTGCTAACCAAGTGCTGTGGG - Intronic
1200292410 X:154886072-154886094 GGCTGCAATGCAAGTGGTCTAGG - Intronic
1200339253 X:155381812-155381834 GGCTGCAATGCAAGTGGTCTAGG - Intergenic
1200347217 X:155458881-155458903 GGCTGCAATGCAAGTGGTCTAGG + Intergenic